version
PlantPromoterDB promoter information of AT5G14580.1

Summary of Gene (AT5G14580.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G14580  TAIR      NCBI 
Gene model AT5G14580.1  
Description polyribonucleotide nucleotidyltransferase, putative; FUNCTIONS IN: polyribonucleotide nucleotidyltransferase activity, 3'-5'-exoribonuclease activity, RNA binding, nucleic acid binding; INVOLVED IN: mRNA catabolic process, RNA processing; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), K Homology, type 1, subgroup (InterPro:IPR018111), Exoribonuclease, phosphorolytic domain 2 (InterPro:IPR015847), S1, RNA binding (InterPro:IPR003029), Polynucleotide phosphorylase, phosphorolytic RNA-binding, bacterial/organelle-type (InterPro:IPR015848), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), K Homology (InterPro:IPR004087), Exoribonuclease, phosphorolytic domain 1 (InterPro:IPR001247), Polyribonucleotide nucleotidyltransferase (InterPro:IPR012162); BEST Arabidopsis thaliana protein match is: RIF10 (resistant to inhibition with FSM 10); 3'-5'-exoribonuclease/ RNA binding / nucleic acid binding / polyribonucleotide nucleotidyltransferase (TAIR:AT3G03710.1); Has 19856 Blast hits to 18048 proteins in 1642 species: Archae - 206; Bacteria - 10090; Metazoa - 440; Fungi - 100; Plants - 266; Viruses - 0; Other Eukaryotes - 8754 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 4707513-4706314)

Genome position     
from initiation codon
AT5G14590.1         
TSS from cDNA
TSS information
AT5G14580.1                      5'->3' (-)
Promoter sequence











 
AT5G14600.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence











 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G14580.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2-4703615-602

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCAAACCG-47037064703713-693-700
 AtREG550CCAAACCG PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA5+4706974AT5G14600.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-4706738AT5G14590.1
TSS cloneAclone-4706735AT5G14590.1
TSS cloneTclone-4706734AT5G14590.1
TSS clone peakAclone-4706732AT5G14590.1
TSS cloneCclone-4706698AT5G14590.1
TSS cloneGclone+4706983AT5G14600.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTTTTCCTTCT-47067704706784AT5G14590.1
Y PatchTTCTTCCTTCTC+47069844706995AT5G14600.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTACTGGGCCTTATGTTGGGCCTAC-47068024706825AT5G14590.1
 AtREG434TACTGGGC                 PPDB MotifGCCCA  PLACE Motif 
 AtREG384 ACTGGGCC                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG410  CTGGGCCT               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353   TGGGCCTT              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG351    GGGCCTTA             PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG425     GGCCTTAT            PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG543            TGTTGGGC     PPDB MotifGCCCA  PLACE MotifCAACA 
 AtREG449             GTTGGGCC    PPDB MotifGCCCA, CCAACGG  PLACE MotifGGGCC, TGGGCY 
 AtREG356              TTGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358               TGGGCCTA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG435                GGGCCTAC PPDB MotifGCCCA  PLACE MotifGGGCC 
REGATCCGGTTTGG-47068474706857AT5G14590.1
 AtREG561ATCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496  CCGGTTTG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG550   CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGCGAACCGGC-47068604706868AT5G14590.1
 AtREG423CGAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG637 GAACCGGC PPDB MotifAACCG(G/A)  PLACE Motif 
REGAACCGGAC-47068914706898AT5G14590.1
 AtREG573AACCGGAC PPDB MotifAACCG(G/A)  PLACE Motif 
REGGTAGGCCCAACATAAGGCCCAGTA+47068024706825AT5G14600.1
 AtREG435GTAGGCCC                 PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358 TAGGCCCA                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  AGGCCCAA               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG449   GGCCCAAC              PPDB MotifGCCCA, CCAACGG  PLACE MotifGGGCC, TGGGCY 
 AtREG543    GCCCAACA             PPDB MotifGCCCA  PLACE MotifCAACA 
 AtREG425           ATAAGGCC      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG351            TAAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353             AAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG410              AGGCCCAG   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG384               GGCCCAGT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG434                GCCCAGTA PPDB MotifGCCCA  PLACE Motif 
REGCCAAACCGGAT+47068474706857AT5G14600.1
 AtREG550CCAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496 CAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521  AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561   AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGGCCGGTTCG+47068604706868AT5G14600.1
 AtREG637GCCGGTTC  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423 CCGGTTCG PPDB MotifAACCG(G/A)  PLACE Motif 
REGGTCCGGTT+47068914706898AT5G14600.1
 AtREG573GTCCGGTT PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.