version
PlantPromoterDB promoter information of AT5G14580.1

Summary of Gene (AT5G14580.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G14580  TAIR      NCBI 
Gene model AT5G14580.1  
Description polyribonucleotide nucleotidyltransferase, putative; FUNCTIONS IN: polyribonucleotide nucleotidyltransferase activity, 3'-5'-exoribonuclease activity, RNA binding, nucleic acid binding; INVOLVED IN: mRNA catabolic process, RNA processing; EXPRESSED IN: 16 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold (InterPro:IPR012340), K Homology, type 1, subgroup (InterPro:IPR018111), Exoribonuclease, phosphorolytic domain 2 (InterPro:IPR015847), S1, RNA binding (InterPro:IPR003029), Polynucleotide phosphorylase, phosphorolytic RNA-binding, bacterial/organelle-type (InterPro:IPR015848), Nucleic acid-binding, OB-fold-like (InterPro:IPR016027), K Homology (InterPro:IPR004087), Exoribonuclease, phosphorolytic domain 1 (InterPro:IPR001247), Polyribonucleotide nucleotidyltransferase (InterPro:IPR012162); BEST Arabidopsis thaliana protein match is: RIF10 (resistant to inhibition with FSM 10); 3'-5'-exoribonuclease/ RNA binding / nucleic acid binding / polyribonucleotide nucleotidyltransferase (TAIR:AT3G03710.1); Has 19856 Blast hits to 18048 proteins in 1642 species: Archae - 206; Bacteria - 10090; Metazoa - 440; Fungi - 100; Plants - 266; Viruses - 0; Other Eukaryotes - 8754 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 4708063-4706864)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G14580.1                      5'->3' (-)
Promoter sequence


 
AT5G14600.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G14580.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2-4703615-602

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCAAACCG-47037064703713-693-700
 AtREG550CCAAACCG PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA5+4706974AT5G14600.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+4706983AT5G14600.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTTCCTTCTC+47069844706995AT5G14600.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCGAACCGGC-47068604706868AT5G14590.1
 AtREG423CGAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG637 GAACCGGC PPDB MotifAACCG(G/A)  PLACE Motif 
REGAACCGGAC-47068914706898AT5G14590.1
 AtREG573AACCGGAC PPDB MotifAACCG(G/A)  PLACE Motif 
REGGCCGGTTCG+47068604706868AT5G14600.1
 AtREG637GCCGGTTC  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423 CCGGTTCG PPDB MotifAACCG(G/A)  PLACE Motif 
REGGTCCGGTT+47068914706898AT5G14600.1
 AtREG573GTCCGGTT PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.