version
PlantPromoterDB promoter information of AT5G15200

Summary of Gene (AT5G15200)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G15200  TAIR      NCBI 
Gene model AT5G15200  
Description 40S ribosomal protein S9 (RPS9B); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: in 7 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S4 (InterPro:IPR001912), Ribosomal protein S4, conserved site (InterPro:IPR018079), Ribosomal protein S4/S9, eukaryotic/archaeal (InterPro:IPR005710), RNA-binding S4 (InterPro:IPR002942); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S9 (RPS9C) (TAIR:AT5G39850.1); Has 4591 Blast hits to 4589 proteins in 2325 species: Archae - 171; Bacteria - 272; Metazoa - 335; Fungi - 189; Plants - 2943; Viruses - 0; Other Eukaryotes - 681 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 4937334-4936135)

Genome position     
from initiation codon
AT5G15200.1         
AT5G15200.2         
TSS from cDNA
TSS information
AT5G15200                        5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G15200

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG154-4936384-50

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-4936389-55
TSS cloneTclone-4936387-53
TSS cloneCclone-4936386-52
TSS cloneTclone-4936385-51
TSS cloneGclone-4936384-50
TSS cloneCclone-4936383-49
TSS cloneGclone-4936382-48
TSS cloneTclone-4936381-47
TSS cloneCclone-4936379-45
TSS cloneGclone-4936374-40
TSS cloneTclone-4936370-36

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCCTATAAATT-49364134936423-79-89
Y PatchTTCCTCTCT-49363854936393-51-59
Y PatchTCTCTTTC-49363954936402-61-68
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAAGGCCCAATAA-49364594936472-125-138
 AtREG467TAAAGGCC       PPDB Motif  PLACE Motif 
 AtREG359 AAAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   AGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352    GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355     GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG417      CCCAATAA PPDB MotifGCCCA  PLACE Motif 
REGTAAAGGCCCAATATAAAGCC-49364814936500-147-166
 AtREG467TAAAGGCC             PPDB Motif  PLACE Motif 
 AtREG359 AAAGGCCC            PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   AGGCCCAA          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352    GGCCCAAT         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355     GCCCAATA        PPDB MotifGCCCA  PLACE Motif 
 AtREG509      CCCAATAT       PPDB Motif  PLACE Motif 
 AtREG601            ATAAAGCC PPDB Motif  PLACE Motif 
REGTCAAAACGGGCCCAATATAAAGCC-49365094936532-175-198
 AtREG653TCAAAACG                 PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG401    AACGGGCC             PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE MotifGGGCC 
 AtREG392       GGGCCCAA          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352        GGCCCAAT         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355         GCCCAATA        PPDB MotifGCCCA  PLACE Motif 
 AtREG509          CCCAATAT       PPDB Motif  PLACE Motif 
 AtREG601                ATAAAGCC PPDB Motif  PLACE Motif 
REGGAGCCCAA-49365614936568-227-234
 AtREG533GAGCCCAA PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.