version
PlantPromoterDB promoter information of AT5G15700.1

Summary of Gene (AT5G15700.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G15700  TAIR      NCBI 
Gene model AT5G15700.1  
Description DNA-directed RNA polymerase (RPOT2); FUNCTIONS IN: DNA-directed RNA polymerase activity, DNA binding; INVOLVED IN: transcription; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: DNA-directed RNA polymerase, bacteriophage type (InterPro:IPR002092); BEST Arabidopsis thaliana protein match is: DNA-directed RNA polymerase, mitochondrial (RPOMT) (TAIR:AT1G68990.1); Has 1079 Blast hits to 1064 proteins in 245 species: Archae - 0; Bacteria - 22; Metazoa - 122; Fungi - 163; Plants - 126; Viruses - 102; Other Eukaryotes - 544 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 5122609-5121410)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G15700.1                      5'->3' (-)
Promoter sequence





 
AT5G15710.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence









 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G15700.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG2-5121854-245

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGGGTCGA-51218945121901-285-292
 AtREG539CGGGTCGA PPDB Motif  PLACE Motif 
REGCCCGGGTCGGGT-51219165121927-307-318
 AtREG593CCCGGGTC     PPDB MotifGGGACCC  PLACE Motif 
 AtREG494 CCGGGTCG    PPDB Motif  PLACE Motif 
 AtREG375  CGGGTCGG   PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG442   GGGTCGGG  PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG405    GGTCGGGT PPDB MotifCCGAC  PLACE MotifCCGAC 
REGGGCCTTAA-51219385121945-329-336
 AtREG416GGCCTTAA PPDB Motif  PLACE Motif 
REGTTTGGGCCGTT-51219525121962-343-353
 AtREG373TTTGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414 TTGGGCCG   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG368  TGGGCCGT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG377   GGGCCGTT PPDB MotifGCCCA, AAACG(C/G)  PLACE MotifGGGCC 
REGTAATTGGGCTC-51220005122010-391-401
 AtREG600TAATTGGG    PPDB MotifGCCCA  PLACE Motif 
 AtREG418 AATTGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG402  ATTGGGCT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG533   TTGGGCTC PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTAATTGGG-51220915122098-482-489
 AtREG600TAATTGGG PPDB MotifGCCCA  PLACE Motif 
REGTAATTGGG-51221225122129-513-520
 AtREG600TAATTGGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+5122492AT5G15710.1
TSS clone peakTclone+5122508AT5G15710.1
TSS cloneGclone+5122509AT5G15710.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTCTCT+51224815122491AT5G15710.1
Y PatchTCTCTCTCTTCTTC+51224935122506AT5G15710.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGACCCCTTA+51223985122405AT5G15710.1
 AtREG636ACCCCTTA PPDB MotifACCCCT  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.