version
PlantPromoterDB promoter information of AT5G16260.1

Summary of Gene (AT5G16260.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G16260  TAIR      NCBI 
Gene model AT5G16260.1  
Description RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677), GYF (InterPro:IPR003169); Has 1767 Blast hits to 1758 proteins in 207 species: Archae - 0; Bacteria - 82; Metazoa - 1049; Fungi - 296; Plants - 184; Viruses - 0; Other Eukaryotes - 156 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 5310363-5311562)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G16260.1                      5'->3' (+)
Promoter sequence






 
AT5G16250.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence









 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G16260.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+5311207-156
TSS clone peakTclone+5311208-155

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTTCCTCCT+53112435311254-120-109
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACCGTTG+53109895310996-374-367
 AtREG553GACCGTTGAuxin PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
REGTGGGCCCAATG+53110475311057-316-306
 AtREG422TGGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG392 GGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352  GGCCCAAT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG461   GCCCAATG PPDB MotifGCCCA  PLACE Motif 
REGGTGGGCCTAGTGGGCCGT+53110845311101-279-262
 AtREG482GTGGGCCT           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358 TGGGCCTA          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG475  GGGCCTAG         PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG532       TAGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG368          TGGGCCGT PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGGGGCCTAATGGGCCG+53111565311170-207-193
 AtREG360GGGCCTAA        PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG506 GGCCTAAT       PPDB Motif  PLACE Motif 
 AtREG558    CTAATGGG    PPDB MotifGCCCA  PLACE Motif 
 AtREG357     TAATGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG361      AATGGGCC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380       ATGGGCCG PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA13-5310907AT5G16250.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-5310951AT5G16250.1
TSS cloneCclone-5310908AT5G16250.1
TSS cloneAclone-5310907AT5G16250.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTTCTTCTTCTTCT-53108805310895AT5G16250.1
Y PatchCTCTTCTC-53109145310921AT5G16250.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCAACGGTC-53109895310996AT5G16250.1
 AtREG553CAACGGTCAuxin PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
REGCATTGGGCCCA-53110475311057AT5G16250.1
 AtREG461CATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG352 ATTGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG392  TTGGGCCC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG422   TGGGCCCA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGACGGCCCACTAGGCCCAC-53110845311101AT5G16250.1
 AtREG368ACGGCCCA           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG532   GCCCACTA        PPDB MotifGCCCA  PLACE Motif 
 AtREG475        CTAGGCCC   PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358         TAGGCCCA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG482          AGGCCCAC PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGACGGCCCATTAGGCCC-53111565311171AT5G16250.1
 AtREG368ACGGCCCA         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380 CGGCCCAT        PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361  GGCCCATT       PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357   GCCCATTA      PPDB MotifGCCCA  PLACE Motif 
 AtREG558    CCCATTAG     PPDB MotifGCCCA  PLACE Motif 
 AtREG506       ATTAGGCC  PPDB Motif  PLACE Motif 
 AtREG360        TTAGGCCC PPDB MotifGCCCA  PLACE MotifGGGCC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.