version
PlantPromoterDB promoter information of AT5G16640.1

Summary of Gene (AT5G16640.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G16640  TAIR      NCBI 
Gene model AT5G16640.1  
Description pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: F mature embryo stage, 4 leaf senescence stage, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G62680.1); Has 27324 Blast hits to 6063 proteins in 188 species: Archae - 4; Bacteria - 18; Metazoa - 819; Fungi - 570; Plants - 24583; Viruses - 0; Other Eukaryotes - 1330 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 5460031-5461230)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G16640.1                      5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G16640.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+5460976-55

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTCTCCTCCTCCTTC+54609665460983-65-48
Y PatchCTCTCTTCC+54609875460995-44-36
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAACCGGGTT+54608445460852-187-179
 AtREG455AACCGGGT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG516 ACCGGGTT PPDB Motif  PLACE Motif 
REGATCCGGTTTG+54608685460877-163-154
 AtREG561ATCCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496  CCGGTTTG PPDB MotifAACCG(G/A)  PLACE Motif 
REGCCCAATTA+54609055460912-126-119
 AtREG600CCCAATTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.