version
PlantPromoterDB promoter information of AT5G17410.1

Summary of Gene (AT5G17410.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G17410  TAIR      NCBI 
Gene model AT5G17410.1  
Description tubulin family protein; INVOLVED IN: microtubule cytoskeleton organization; LOCATED IN: spindle pole, microtubule organizing center; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Spc97/Spc98 (InterPro:IPR007259); BEST Arabidopsis thaliana protein match is: SPC98 (SPINDLE POLE BODY COMPONENT 98); tubulin binding (TAIR:AT5G06680.1); Has 1020 Blast hits to 940 proteins in 155 species: Archae - 0; Bacteria - 0; Metazoa - 554; Fungi - 217; Plants - 91; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 5729651-5730850)

Genome position     
from initiation codon
AT5G17410.2         
TSS from cDNA
TSS information
AT5G17410.1                      5'->3' (+)
Promoter sequence




 
AT5G17400.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G17410.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+5730610-41
TSS clone peakAclone+5730642-9
TSS cloneGclone+5730645-6

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGTTTTGA+57303535730360-298-291
 AtREG653CGTTTTGA PPDB MotifAAACG(C/G)  PLACE Motif 
REGAAAACCGGAC+57305315730540-120-111
 AtREG542AAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG573  AACCGGAC PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAAACCGGA+57305505730558-101-93
 AtREG542AAAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 AAACCGGA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTGGTTCGGT+57305615730569-90-82
 AtREG655TGGTTCGG  PPDB Motif  PLACE Motif 
 AtREG451 GGTTCGGT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGTCCGGTTTT-57305315730540AT5G17400.1
 AtREG573GTCCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG542  CCGGTTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTCCGGTTTT-57305505730558AT5G17400.1
 AtREG521TCCGGTTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG542 CCGGTTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGACCGAACCA-57305615730569AT5G17400.1
 AtREG451ACCGAACC  PPDB Motif  PLACE Motif 
 AtREG655 CCGAACCA PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.