version
PlantPromoterDB promoter information of AT5G18200.1

Summary of Gene (AT5G18200.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G18200  TAIR      NCBI 
Gene model AT5G18200.1  
Description encodes an adenylyltransferase  
#
#

Overview

Focused view (chromosome 5: 6014270-6015469)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G18200.1                      5'->3' (+)
Promoter sequence









 
AT5G18190.2         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence


 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G18200.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG55+6015225-45

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+6015226-44
TSS cloneAclone+6015229-41
TSS cloneTclone+6015234-36

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGCACGTGTATAAGGGC+60149776014993-293-277
 AtREG541CGCACGTG          PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG453  CACGTGTA       ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACACNNG 
 AtREG616         ATAAGGGC PPDB Motif  PLACE Motif 
REGTTCGGTTTGG+60150986015107-172-163
 AtREG568TTCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG550  CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGTCGGTTCG+60151456015152-125-118
 AtREG575TCGGTTCG PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTTCCGGTTCAA+60151566015167-114-103
 AtREG644TTTCCGGT     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534 TTCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579  TCCGGTTC   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480   CCGGTTCA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG640    CGGTTCAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTAAACCGGAA+60151696015179-101-91
 AtREG473TTAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521  AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534   AACCGGAA PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-6014689AT5G18190.1, AT5G18190.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTTC-60146436014650AT5G18190.1, AT5G18190.2
Y PatchTCTTCTTC-60146526014659AT5G18190.1, AT5G18190.2
Y PatchCCTCCTCT-60146626014669AT5G18190.1, AT5G18190.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTACACGTGCG-60149776014986AT5G18190.1, AT5G18190.2
 AtREG453TACACGTG  ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACACNNG 
 AtREG541  CACGTGCG PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.