version
PlantPromoterDB promoter information of AT5G19510

Summary of Gene (AT5G19510)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G19510  TAIR      NCBI 
Gene model AT5G19510  
Description elongation factor 1B alpha-subunit 2 (eEF1Balpha2); FUNCTIONS IN: translation elongation factor activity; INVOLVED IN: translational elongation, defense response to bacterium; LOCATED IN: apoplast, eukaryotic translation elongation factor 1 complex; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EF1B/ribosomal protein S6 (InterPro:IPR014717), Translation elongation factor EF1B, beta and delta chains, guanine nucleotide exchange (InterPro:IPR014038), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Translation elongation factor EF1B, beta/delta chains, conserved site (InterPro:IPR001326); BEST Arabidopsis thaliana protein match is: elongation factor 1B alpha-subunit 1 (eEF1Balpha1) (TAIR:AT5G12110.1); Has 715 Blast hits to 715 proteins in 199 species: Archae - 0; Bacteria - 2; Metazoa - 371; Fungi - 103; Plants - 110; Viruses - 0; Other Eukaryotes - 129 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 6584137-6582938)

Genome position     
from initiation codon
AT5G19510.1         
TSS from cDNA
TSS information
AT5G19510                        5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G19510

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA83-6583185-48

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-6583248-111
TSS cloneGclone-6583222-85
TSS cloneGclone-6583217-80
TSS cloneTclone-6583214-77
TSS cloneTclone-6583212-75
TSS cloneGclone-6583201-64
TSS cloneCclone-6583191-54
TSS cloneGclone-6583184-47
TSS cloneTclone-6583183-46
TSS cloneTclone-6583181-44
TSS cloneCclone-6583180-43
TSS cloneGclone-6583176-39
TSS cloneAclone-6583175-38
TSS cloneTclone-6583174-37
TSS cloneTclone-6583170-33
TSS cloneCclone-6583169-32
TSS cloneTclone-6583168-31

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCCTC-65831596583166-22-29
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAGGCCCATAAATAAGCCCAAAT-65832666583288-129-151
 AtREG353AAGGCCCA                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354 AGGCCCAT               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG364  GGCCCATA              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG394   GCCCATAA             PPDB MotifGCCCA  PLACE Motif 
 AtREG462           ATAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG426            TAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407             AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469              AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG421               GCCCAAAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.