version
PlantPromoterDB promoter information of AT5G19660.1

Summary of Gene (AT5G19660.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G19660  TAIR      NCBI 
Gene model AT5G19660.1  
Description S1P appears to function as a Golgi-localized subtilase and to help protect seedlings against salt and osmotic stress. The roots of s1p-3 mutants are hypersensitive to NaCl, KCl, LiCl, and mannitol. Several salt-stress responsive genes show weaker induction in an s1P-3 mutant background. The proteolytic cleavage of the bZIP17 transcription factor depends on S1P in vitro. And there is evidence that S1P can cleave bZIP17 in vitro.  
#
#

Overview

Focused view (chromosome 5: 6647418-6646219)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G19660.1                      5'->3' (-)
Promoter sequence





 
AT5G19670.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G19660.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA5-6646531-113

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-6646530-112
TSS cloneAclone-6646528-110
TSS cloneAclone-6646512-94

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAACCGGT-66465896646596-171-178
 AtREG528GAACCGGT PPDB MotifAACCG(G/A)  PLACE Motif 
REGATAAACCGAA-66466246646633-206-215
 AtREG598ATAAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCCAAACCGAACCA-66466536646665-235-247
 AtREG550CCAAACCG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556   AACCGAAC   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451    ACCGAACC  PPDB Motif  PLACE Motif 
 AtREG655     CCGAACCA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone+6646719AT5G19670.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTGAACCGGC+66465596646568AT5G19670.1
 AtREG640TTGAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480 TGAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG637  GAACCGGC PPDB MotifAACCG(G/A)  PLACE Motif 
REGACCGGTTC+66465896646596AT5G19670.1
 AtREG528ACCGGTTC PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTCGGTTTAT+66466246646633AT5G19670.1
 AtREG568TTCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG598  CGGTTTAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTGGTTCGGTTTGG+66466536646665AT5G19670.1
 AtREG655TGGTTCGG      PPDB Motif  PLACE Motif 
 AtREG451 GGTTCGGT     PPDB Motif  PLACE Motif 
 AtREG556  GTTCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568   TTCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG550     CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.