PlantPromoterDB promoter information of AT5G19920.1

Summary of Gene (AT5G19920.1)

Organism	Arabidopsis thaliana
Chromosome	5
Locus	AT5G19920 TAIR NCBI
Gene model	AT5G19920.1
Description	transducin family protein / WD-40 repeat family protein; FUNCTIONS IN: nucleotide binding; INVOLVED IN: biological_process unknown; LOCATED IN: CUL4 RING ubiquitin ligase complex; EXPRESSED IN: 10 plant structures; EXPRESSED DURING: 6 growth stages; CONTAINS InterPro DOMAIN/s: WD40 repeat-like (InterPro:IPR011046), WD40 repeat, region (InterPro:IPR017986), WD40/YVTN repeat-like (InterPro:IPR015943), WD40 repeat (InterPro:IPR001680); BEST Arabidopsis thaliana protein match is: WD-40 repeat family protein (TAIR:AT5G50970.1); Has 820 Blast hits to 752 proteins in 164 species: Archae - 4; Bacteria - 193; Metazoa - 265; Fungi - 128; Plants - 83; Viruses - 0; Other Eukaryotes - 147 (source: NCBI BLink).

#

Overview

Focused view (chromosome 5: 6739466-6738267)

`Genome position from initiation codon` `AT5G19930.1 TSS from cDNA TSS information AT5G19920.1 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G19920.1

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak G 13 - 6737382 -116

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`G`	13	-	6737382	-116

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone A clone - 6737373 -107

TSS clone A clone - 6737372 -106

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`A`	clone	-	6737373	-107
TSS clone	`A`	clone	-	6737372	-106

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG None None None

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	None	None	None

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone A clone - 6739348 AT5G19930.1

TSS clone peak A clone - 6739347 AT5G19930.1

TSS clone C clone - 6739292 AT5G19930.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`A`	clone	-	6739348	AT5G19930.1
TSS clone peak	`A`	clone	-	6739347	AT5G19930.1
TSS clone	`C`	clone	-	6739292	AT5G19930.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch CCCTCTCC - 6739336 6739343 AT5G19930.1

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`CCCTCTCC`	-	6739336	6739343	AT5G19930.1
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG CTATTGGGTCAGCCCATTTGAGGCCCATG - 6739430 6739458 AT5G19930.1

AtREG624 CTATTGGG                      PPDB Motif GCCCA PLACE Motif

AtREG609         TCAGCCCA              PPDB Motif GCCCA PLACE Motif TGGGCY

AtREG372           AGCCCATT            PPDB Motif GCCCA PLACE Motif TGGGCY

AtREG386            GCCCATTT           PPDB Motif GCCCA PLACE Motif

AtREG587                   TGAGGCCC    PPDB Motif GCCCA PLACE Motif GGGCC

AtREG447                    GAGGCCCA   PPDB Motif GCCCA PLACE Motif GGGCC, TGGGCY

AtREG354                     AGGCCCAT PPDB Motif GCCCA PLACE Motif GGGCC, TGGGCY

AtREG504                      GGCCCATG PPDB Motif GCCCA, CCATGG PLACE Motif GGGCC, TGGGCY

REG CATGGGCCTCAAATGGGCTGACCCAATAG + 6739430 6739458 AT5G19940.1, AT5G19940.2

AtREG504 CATGGGCC                      PPDB Motif GCCCA, CCATGG PLACE Motif GGGCC, TGGGCY

AtREG354 ATGGGCCT                     PPDB Motif GCCCA PLACE Motif GGGCC, TGGGCY

AtREG447   TGGGCCTC                    PPDB Motif GCCCA PLACE Motif GGGCC, TGGGCY

AtREG587    GGGCCTCA                   PPDB Motif GCCCA PLACE Motif GGGCC

AtREG386           AAATGGGC            PPDB Motif GCCCA PLACE Motif

AtREG372            AATGGGCT           PPDB Motif GCCCA PLACE Motif TGGGCY

AtREG609              TGGGCTGA         PPDB Motif GCCCA PLACE Motif TGGGCY

AtREG624                      CCCAATAG PPDB Motif GCCCA PLACE Motif