version
PlantPromoterDB promoter information of AT5G19960.1

Summary of Gene (AT5G19960.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G19960  TAIR      NCBI 
Gene model AT5G19960.1  
Description RNA recognition motif (RRM)-containing protein; FUNCTIONS IN: RNA binding, nucleotide binding, nucleic acid binding; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: RNA recognition motif, glycine rich protein (InterPro:IPR015465), RNA recognition motif, RNP-1 (InterPro:IPR000504), Nucleotide-binding, alpha-beta plait (InterPro:IPR012677); BEST Arabidopsis thaliana protein match is: GR-RBP8; RNA binding / nucleic acid binding / nucleotide binding (TAIR:AT4G39260.2); Has 17397 Blast hits to 14212 proteins in 592 species: Archae - 12; Bacteria - 964; Metazoa - 9774; Fungi - 1887; Plants - 2774; Viruses - 3; Other Eukaryotes - 1983 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 6740629-6741828)

Genome position     
from initiation codon
AT5G19940.1         
AT5G19940.2         
TSS from cDNA
TSS information
AT5G19960.1                      5'->3' (+)
Promoter sequence

 
AT5G19950.1         
AT5G19950.2         
AT5G19950.3         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G19960.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+6744021-8

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAATTGGG+67437306743737-299-292
 AtREG647CAATTGGG PPDB Motif  PLACE Motif 
REGCGTTTTGA+67438326743839-197-190
 AtREG653CGTTTTGA PPDB MotifAAACG(C/G)  PLACE Motif 
REGTTTCCGGTTT+67439106743919-119-110
 AtREG644TTTCCGGT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534 TTCCGGTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521  TCCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTAGTGGGCCTAATGGCCCATAT+67439256743946-104-83
 AtREG532TAGTGGGC               PPDB MotifGCCCA  PLACE Motif 
 AtREG482  GTGGGCCT             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358   TGGGCCTA            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG360    GGGCCTAA           PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG506     GGCCTAAT          PPDB Motif  PLACE Motif 
 AtREG437           ATGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490            TGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG364             GGCCCATA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG432              GCCCATAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.