version
PlantPromoterDB promoter information of AT5G20290

Summary of Gene (AT5G20290)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G20290  TAIR      NCBI 
Gene model AT5G20290  
Description 40S ribosomal protein S8 (RPS8A); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 8 components; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S8e (InterPro:IPR001047), Ribosomal protein S8e, conserved site (InterPro:IPR018283); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S8 (RPS8B) (TAIR:AT5G59240.1); Has 801 Blast hits to 797 proteins in 322 species: Archae - 165; Bacteria - 0; Metazoa - 295; Fungi - 110; Plants - 75; Viruses - 0; Other Eukaryotes - 156 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 6854012-6852813)

Genome position     
from initiation codon
AT5G20290.1         
AT5G20300.1         
AT5G20300.2         
AT5G20300.3         
TSS from cDNA
TSS information
AT5G20290                        5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G20290

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4-6853848-836
TSS peakA77-6853058-46

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-6853847-835
TSS cloneCclone-6853064-52
TSS cloneCclone-6853063-51
TSS cloneTclone-6853062-50
TSS cloneTclone-6853060-48
TSS cloneAclone-6853058-46
TSS cloneAclone-6853057-45
TSS cloneCclone-6853056-44
TSS cloneTclone-6853055-43
TSS cloneCclone-6853053-41
TSS cloneGclone-6853052-40
TSS cloneCclone-6853051-39
TSS cloneCclone-6853049-37

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCCCTATATATT-68530886853099-76-87
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGATGGGCCA-68531226853130-110-118
 AtREG403GATGGGCC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490 ATGGGCCA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGATGGGCTTGGCCCAAAGGCC-68531386853157-126-145
 AtREG378ATGGGCTT             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG525 TGGGCTTG            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG484      TTGGCCCA       PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420       TGGCCCAA      PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373        GGCCCAAA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG656            CAAAGGCC PPDB Motif  PLACE Motif 
REGAAAACGGC-68531746853181-162-169
 AtREG531AAAACGGC PPDB MotifAAACG(C/G)  PLACE Motif 
REGCTTATTGG-68539486853955-936-943
 AtREG611CTTATTGG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.