PlantPromoterDB promoter information of AT5G20290
Summary of Gene (AT5G20290)
|
Overview
|
Focused view (chromosome 5: 6854012-6852813)
|
Genome position
from initiation codon AT5G20300.1 AT5G20300.2 AT5G20300.3 TSS from cDNA TSS information AT5G20290 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT5G20290
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | A | 4 | - | 6853848 | -836 |
| TSS peak | A | 77 | - | 6853058 | -46 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | T | clone | - | 6853847 | -835 |
| TSS clone | C | clone | - | 6853064 | -52 |
| TSS clone | C | clone | - | 6853063 | -51 |
| TSS clone | T | clone | - | 6853062 | -50 |
| TSS clone | T | clone | - | 6853060 | -48 |
| TSS clone | A | clone | - | 6853058 | -46 |
| TSS clone | A | clone | - | 6853057 | -45 |
| TSS clone | C | clone | - | 6853056 | -44 |
| TSS clone | T | clone | - | 6853055 | -43 |
| TSS clone | C | clone | - | 6853053 | -41 |
| TSS clone | G | clone | - | 6853052 | -40 |
| TSS clone | C | clone | - | 6853051 | -39 |
| TSS clone | C | clone | - | 6853049 | -37 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | TCCCTATATATT | - | 6853088 | 6853099 | -76 | -87 |
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | GATGGGCCA | - | 6853122 | 6853130 | -110 | -118 | |||
| AtREG403 | GATGGGCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG490 | ATGGGCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| REG | ATGGGCTTGGCCCAAAGGCC | - | 6853138 | 6853157 | -126 | -145 | |||
| AtREG378 | ATGGGCTT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG525 | TGGGCTTG | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG484 | TTGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG420 | TGGCCCAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG373 | GGCCCAAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG656 | CAAAGGCC | PPDB Motif | PLACE Motif | ||||||
| REG | AAAACGGC | - | 6853174 | 6853181 | -162 | -169 | |||
| AtREG531 | AAAACGGC | PPDB Motif | AAACG(C/G) | PLACE Motif | |||||
| REG | CTTATTGG | - | 6853948 | 6853955 | -936 | -943 | |||
| AtREG611 | CTTATTGG | PPDB Motif | PLACE Motif | ||||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||