version
PlantPromoterDB promoter information of AT5G20520.1

Summary of Gene (AT5G20520.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G20520  TAIR      NCBI 
Gene model AT5G20520.1  
Description Encodes a Bem46-like protein. WAV2 negatively regulates root bending when roots alter their growth direction. It's not involved in sensing environmental stimuli (e.g. gravity, light, water, touch).  
#
#

Overview

Focused view (chromosome 5: 6947315-6946116)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G20520.1                      5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G20520.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA23-6946425-110
TSS peakA4-6946317-2

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-6946459-144
TSS cloneCclone-6946450-135
TSS cloneCclone-6946449-134
TSS cloneTclone-6946448-133
TSS cloneTclone-6946446-131
TSS cloneCclone-6946424-109

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTCGGCCCAGT-69465176946527-202-212
 AtREG427TTCGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG393 TCGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG384   GGCCCAGT PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGAGATGGGCTTTA-69465306946541-215-226
 AtREG572AGATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG378  ATGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365    GGGCTTTA PPDB MotifGCCCA  PLACE Motif 
REGCGGTTTGG-69465536946560-238-245
 AtREG550CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.