version
PlantPromoterDB promoter information of AT5G20900.1

Summary of Gene (AT5G20900.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G20900  TAIR      NCBI 
Gene model AT5G20900.1  
Description JASMONATE-ZIM-DOMAIN PROTEIN 12 (JAZ12); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Tify (InterPro:IPR010399), CCT domain-like (InterPro:IPR018467); BEST Arabidopsis thaliana protein match is: JAZ11 (JASMONATE-ZIM-DOMAIN PROTEIN 11) (TAIR:AT3G43440.1); Has 247 Blast hits to 242 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 2; Plants - 245; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 7089883-7091082)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G20900.1                      5'->3' (+)
Promoter sequence



 
AT5G20890.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G20900.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA87+7090791-92

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+7090704-179
TSS cloneGclone+7090742-141
TSS cloneTclone+7090750-133
TSS cloneGclone+7090771-112
TSS cloneGclone+7090789-94
TSS cloneTclone+7090790-93
TSS cloneAclone+7090791-92

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAGCCCAATG+70905057090514-378-369
 AtREG533GAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402 AGCCCAAT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG461  GCCCAATG PPDB MotifGCCCA  PLACE Motif 
REGAACGACACC+70906257090633-258-250
 AtREG527AACGACAC DREB1Aox PPDB Motif  PLACE Motif 
 AtREG599 ACGACACC PPDB Motif  PLACE Motif 
REGAAAGTCAA+70906947090701-189-182
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA8-7090042AT5G20890.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone-7090082AT5G20890.1
TSS cloneCclone-7090081AT5G20890.1
TSS cloneAclone-7090071AT5G20890.1
TSS cloneTclone-7090070AT5G20890.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTTCTTC-70900557090063AT5G20890.1
Y PatchCTCTCTCCTCT-70900737090083AT5G20890.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.