PlantPromoterDB promoter information of AT5G20920.2
Summary of Gene (AT5G20920.2)
|
Overview
|
Focused view (chromosome 5: 7094611-7093412)
|
Genome position
from initiation codon TSS from cDNA TSS information AT5G20920.2 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT5G20920.2
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | A | 20 | - | 7097074 | -413 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | T | clone | - | 7097114 | -453 |
| TSS clone | G | clone | - | 7097109 | -448 |
| TSS clone | C | clone | - | 7097083 | -422 |
| TSS clone | A | clone | - | 7097074 | -413 |
| TSS clone | G | clone | - | 7097073 | -412 |
| TSS clone | C | clone | - | 7097065 | -404 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | CTCTCTCTC | - | 7097075 | 7097083 | -414 | -422 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | None | None | None | ||||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| TSS peak | A | 4 | - | 7094442 | AT5G20910.1 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| TSS clone | G | clone | - | 7094446 | AT5G20910.1 |
| TSS clone | A | clone | - | 7094445 | AT5G20910.1 |
| TSS clone | A | clone | - | 7094442 | AT5G20910.1 |
| TSS clone | T | clone | - | 7094394 | AT5G20910.1 |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | TTTCCTCCT | - | 7094447 | 7094455 | AT5G20910.1 | |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | TTGAACCGAACCAAACCGAAC | - | 7094485 | 7094505 | AT5G20910.1 | ||||
| AtREG640 | TTGAACCG | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG556 | AACCGAAC AACCGAAC | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG451 | ACCGAACC | PPDB Motif | PLACE Motif | ||||||
| AtREG655 | CCGAACCA | PPDB Motif | PLACE Motif | ||||||
| AtREG550 | CCAAACCG | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG568 | AAACCGAA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| REG | CCAAACCGAAC | - | 7094536 | 7094546 | AT5G20910.1 | ||||
| AtREG550 | CCAAACCG | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG568 | AAACCGAA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG556 | AACCGAAC | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| REG | CGGTTTGG | - | 7094600 | 7094607 | AT5G20910.1 | ||||
| AtREG550 | CGGTTTGG | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||