version
PlantPromoterDB promoter information of AT5G20920.2

Summary of Gene (AT5G20920.2)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G20920  TAIR      NCBI 
Gene model AT5G20920.2  
Description protein synthesis initiation factor eIF2 beta  
#
#

Overview

Focused view (chromosome 5: 7095361-7094162)

Genome position     
from initiation codon
AT5G20910.1         
AT5G20920.1         
AT5G20920.3         
TSS from cDNA
TSS information
AT5G20920.2                      5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G20920.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA20-7097074-413

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-7097114-453
TSS cloneGclone-7097109-448
TSS cloneCclone-7097083-422
TSS cloneAclone-7097074-413
TSS cloneGclone-7097073-412
TSS cloneCclone-7097065-404

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCTC-70970757097083-414-422
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4-7094442AT5G20910.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-7094446AT5G20910.1
TSS cloneAclone-7094445AT5G20910.1
TSS cloneAclone-7094442AT5G20910.1
TSS cloneTclone-7094394AT5G20910.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCCTCCT-70944477094455AT5G20910.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTGAACCGAACCAAACCGAAC-70944857094505AT5G20910.1
 AtREG640TTGAACCG              PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556   AACCGAAC  AACCGAAC PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451    ACCGAACC          PPDB Motif  PLACE Motif 
 AtREG655     CCGAACCA         PPDB Motif  PLACE Motif 
 AtREG550          CCAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568            AAACCGAA  PPDB MotifAACCG(G/A)  PLACE Motif 
REGCCAAACCGAAC-70945367094546AT5G20910.1
 AtREG550CCAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556   AACCGAAC PPDB MotifAACCG(G/A)  PLACE Motif 
REGCGGTTTGG-70946007094607AT5G20910.1
 AtREG550CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.