version
PlantPromoterDB promoter information of AT5G20930

Summary of Gene (AT5G20930)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G20930  TAIR      NCBI 
Gene model AT5G20930  
Description Nuclear serine/threonine protein kinase that requires a coiled-coil region for oligomerization and catalytic activity. Required for leaf and flower development. Expression localized to the developing style by stage 13.  
#
#

Overview

Focused view (chromosome 5: 7090513-7091712)

Genome position     
from initiation codon
AT5G20900.1         
TSS from cDNA
TSS information
AT5G20930                        5'->3' (+)
Promoter sequence


 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G20930

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+7097977-236

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTTC+70979307097937-283-276
Y PatchTTCCTCCTTCTCTTTCTCT+70979947098012-219-201
Y PatchTCTTTCTCT+70980187098026-195-187
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCCTTAG+70977217097728-492-485
 AtREG577GGCCTTAG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA87+7090791AT5G20900.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+7090704AT5G20900.1
TSS cloneGclone+7090742AT5G20900.1
TSS cloneTclone+7090750AT5G20900.1
TSS cloneGclone+7090771AT5G20900.1
TSS cloneGclone+7090789AT5G20900.1
TSS cloneTclone+7090790AT5G20900.1
TSS cloneAclone+7090791AT5G20900.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAGCCCAATG+70905067090514AT5G20900.1
 AtREG402AGCCCAAT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG461 GCCCAATG PPDB MotifGCCCA  PLACE Motif 
REGAACGACACC+70906257090633AT5G20900.1
 AtREG527AACGACAC DREB1Aox PPDB Motif  PLACE Motif 
 AtREG599 ACGACACC PPDB Motif  PLACE Motif 
REGAAAGTCAA+70906947090701AT5G20900.1
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.