version
PlantPromoterDB promoter information of AT5G23090.4

Summary of Gene (AT5G23090.4)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G23090  TAIR      NCBI 
Gene model AT5G23090.4  
Description NUCLEAR FACTOR Y, SUBUNIT B13 (NF-YB13); FUNCTIONS IN: transcription factor activity; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcription factor CBF/NF-Y/archaeal histone (InterPro:IPR003958), Histone-fold (InterPro:IPR009072); BEST Arabidopsis thaliana protein match is: NF-YB12 (NUCLEAR FACTOR Y, SUBUNIT B12); DNA binding / transcription factor (TAIR:AT5G08190.1); Has 987 Blast hits to 987 proteins in 177 species: Archae - 0; Bacteria - 0; Metazoa - 384; Fungi - 235; Plants - 292; Viruses - 0; Other Eukaryotes - 76 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 7748391-7749590)

Genome position     
from initiation codon
AT5G23090.1         
AT5G23090.2         
AT5G23090.3         
TSS from cDNA
TSS information
AT5G23090.4                      5'->3' (+)
Promoter sequence







 
AT5G23080.1         
AT5G23080.2         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence











 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G23090.4

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakTclone+7749070-321
TSS clone peakCclone+7749119-272

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTTGCTATA+77490477749054-344-337
Y PatchCTTCTTCC+77491247749131-267-260
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCTGGGCCTGGTTCGGGTC+77489937749011-398-380
 AtREG397TCTGGGCC            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG410 CTGGGCCT           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG370  TGGGCCTG          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG619   GGGCCTGG         PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG655        TGGTTCGG    PPDB Motif  PLACE Motif 
 AtREG597           TTCGGGTC PPDB MotifGGGACCC  PLACE Motif 
REGTTCGGCCCATTAG+77490167749028-375-363
 AtREG427TTCGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG393 TCGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380  CGGCCCAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361   GGCCCATT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357    GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG558     CCCATTAG PPDB MotifGCCCA  PLACE Motif 
REGTTCACGCGCC+77490727749081-319-310
 AtREG631TTCACGCG  Drought PPDB Motif  PLACE Motif 
 AtREG395 TCACGCGC  PPDB MotifACGCGC  PLACE Motif 
 AtREG486  CACGCGCC PPDB MotifACGCGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG8-7748947AT5G23080.1, AT5G23080.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-7748928AT5G23080.1, AT5G23080.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCTTCTTCTTCTCTCT-77489487748965AT5G23080.1, AT5G23080.2
Y PatchTCTCCTCC-77489837748990AT5G23080.1, AT5G23080.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGACCCGAACCAGGCCCAGA-77489937749011AT5G23080.1, AT5G23080.2
 AtREG597GACCCGAA            PPDB MotifGGGACCC  PLACE Motif 
 AtREG655   CCGAACCA         PPDB Motif  PLACE Motif 
 AtREG619        CCAGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG370         CAGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG410          AGGCCCAG  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG397           GGCCCAGA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGCTAATGGGCCGAA-77490167749028AT5G23080.1, AT5G23080.2
 AtREG558CTAATGGG      PPDB MotifGCCCA  PLACE Motif 
 AtREG357 TAATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG361  AATGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380   ATGGGCCG   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG393    TGGGCCGA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG427     GGGCCGAA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGCGGCGCGTGAA-77490727749082AT5G23080.1, AT5G23080.2
 AtREG538CGGCGCGT    PPDB MotifACGCGC  PLACE Motif 
 AtREG486 GGCGCGTG   PPDB MotifACGCGC  PLACE Motif 
 AtREG395  GCGCGTGA  PPDB MotifACGCGC  PLACE Motif 
 AtREG631   CGCGTGAADrought PPDB Motif  PLACE Motif 
REGAAGCGCGTGAA-77491117749121AT5G23080.1, AT5G23080.2
 AtREG492AAGCGCGT    PPDB MotifACGCGC  PLACE Motif 
 AtREG381 AGCGCGTG   PPDB MotifACGCGC  PLACE Motif 
 AtREG395  GCGCGTGA  PPDB MotifACGCGC  PLACE Motif 
 AtREG631   CGCGTGAADrought PPDB Motif  PLACE Motif 
REGGTCGTTTA-77491407749147AT5G23080.1, AT5G23080.2
 AtREG565GTCGTTTA PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.