PlantPromoterDB promoter information of AT5G23575.1

Summary of Gene (AT5G23575.1)

Organism	Arabidopsis thaliana
Chromosome	5
Locus	AT5G23575 TAIR NCBI
Gene model	AT5G23575.1
Description	transmembrane protein, putative; INVOLVED IN: biological_process unknown; LOCATED IN: endoplasmic reticulum, membrane; EXPRESSED IN: callus, leaf; CONTAINS InterPro DOMAIN/s: Cleft lip and palate transmembrane 1 (InterPro:IPR008429); BEST Arabidopsis thaliana protein match is: transmembrane CLPTM1 family protein (TAIR:AT5G08500.1); Has 385 Blast hits to 385 proteins in 129 species: Archae - 0; Bacteria - 0; Metazoa - 216; Fungi - 50; Plants - 26; Viruses - 0; Other Eukaryotes - 93 (source: NCBI BLink).

#

Overview

Focused view (chromosome 5: 7945563-7946762)

`Genome position from initiation codon` `AT5G23570.1 TSS from cDNA TSS information AT5G23575.1 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G23575.1

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak G 4 + 7946337 -226

TSS peak A 4 + 7946338 -225

TSS peak A 2 + 7946478 -85

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`G`	4	+	7946337	-226
TSS peak	`A`	4	+	7946338	-225
TSS peak	`A`	2	+	7946478	-85

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone T clone + 7946356 -207

TSS clone T clone + 7946402 -161

TSS clone C clone + 7946468 -95

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`T`	clone	+	7946356	-207
TSS clone	`T`	clone	+	7946402	-161
TSS clone	`C`	clone	+	7946468	-95

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch CTCTCTCT + 7946453 7946460 -110 -103

Y Patch TCTCCTTC + 7946480 7946487 -83 -76

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`CTCTCTCT`	+	7946453	7946460	-110	-103
Y Patch	`TCTCCTTC`	+	7946480	7946487	-83	-76
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG TATATGGG + 7946186 7946193 -377 -370

AtREG620 TATATGGG PPDB Motif GCCCA PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`TATATGGG`		+	7946186	7946193	-377	-370
	AtREG620	`TATATGGG`		PPDB Motif	`GCCCA`	PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None