version
PlantPromoterDB promoter information of AT5G23590.1

Summary of Gene (AT5G23590.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G23590  TAIR      NCBI 
Gene model AT5G23590.1  
Description DNAJ heat shock N-terminal domain-containing protein; FUNCTIONS IN: unfolded protein binding, heat shock protein binding; INVOLVED IN: protein folding; LOCATED IN: cellular_component unknown; EXPRESSED IN: male gametophyte; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock protein, Hsp40, DnaJ (InterPro:IPR015609), Heat shock protein DnaJ, N-terminal (InterPro:IPR001623), Heat shock protein DnaJ (InterPro:IPR003095), Heat shock protein DnaJ, conserved site (InterPro:IPR018253); BEST Arabidopsis thaliana protein match is: GFA2 (GAMETOPHYTIC FACTOR 2); heat shock protein binding / unfolded protein binding (TAIR:AT5G48030.1); Has 11753 Blast hits to 11547 proteins in 1607 species: Archae - 76; Bacteria - 3773; Metazoa - 2690; Fungi - 1062; Plants - 639; Viruses - 13; Other Eukaryotes - 3500 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 7955936-7954737)

Genome position     
from initiation codon
AT5G23590.2         
TSS from cDNA
TSS information
AT5G23590.1                      5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G23590.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-7955640-704
TSS cloneTclone-7955635-699
TSS cloneGclone-7955630-694
TSS clone peakAclone-7955622-686
TSS cloneGclone-7955603-667

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCTCTTCTC-79555827955593-646-657
Y PatchTCTCTCCT-79556427955649-706-713
Y PatchTTCTTCTTCTT-79556567955666-720-730
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTCCGGTTTAA-79556807955690-744-754
 AtREG534TTCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412  CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473   CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTCCGGTTCAA-79557237955733-787-797
 AtREG534TTCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579 TCCGGTTC   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480  CCGGTTCA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG640   CGGTTCAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGAACCGCGT-79558227955829-886-893
 AtREG441AACCGCGTDrought PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.