version
PlantPromoterDB promoter information of AT5G25757.1

Summary of Gene (AT5G25757.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G25757  TAIR      NCBI 
Gene model AT5G25757.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25754.1); Has 298 Blast hits to 292 proteins in 123 species: Archae - 0; Bacteria - 0; Metazoa - 156; Fungi - 59; Plants - 28; Viruses - 0; Other Eukaryotes - 55 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 8968460-8967261)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G25757.1                      5'->3' (-)
Promoter sequence




 
AT5G25760.1         
AT5G25760.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G25757.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA26-8967504-44

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-8967542-82
TSS cloneGclone-8967541-81
TSS cloneAclone-8967503-43
TSS cloneGclone-8967502-42
TSS cloneAclone-8967471-11

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAACCGGAT-89675528967560-92-100
 AtREG521AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561 AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGGAACCGGT-89675768967583-116-123
 AtREG528GAACCGGT PPDB MotifAACCG(G/A)  PLACE Motif 
REGATAACCGGAT-89675888967597-128-137
 AtREG548ATAACCGG   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG621 TAACCGGA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG561  AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGCCGAACCA-89676338967640-173-180
 AtREG655CCGAACCA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakTclone+8967689AT5G25760.1, AT5G25760.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.