version
PlantPromoterDB promoter information of AT5G26110.2

Summary of Gene (AT5G26110.2)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G26110  TAIR      NCBI 
Gene model AT5G26110.2  
Description ATP binding / catalytic/ protein kinase; FUNCTIONS IN: protein kinase activity, catalytic activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 11 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), RIO-like kinase (InterPro:IPR018934), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G08120.1); Has 1182 Blast hits to 1178 proteins in 337 species: Archae - 148; Bacteria - 370; Metazoa - 229; Fungi - 137; Plants - 43; Viruses - 0; Other Eukaryotes - 255 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 9119990-9118791)

Genome position     
from initiation codon
AT5G26110.1         
TSS from cDNA
TSS information
AT5G26110.2                      5'->3' (-)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G26110.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8-9119803-813

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-9119826-836
TSS cloneTclone-9119805-815
TSS cloneGclone-9119803-813
TSS cloneTclone-9119802-812

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATAACCGGAA-91198479119856-857-866
 AtREG548ATAACCGG   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG621 TAACCGGA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG534  AACCGGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTCGGTTT-91198789119885-888-895
 AtREG568TTCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAAACCGGTTCA-91198989119909-908-919
 AtREG542AAAACCGG     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436 AAACCGGT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG528   ACCGGTTC  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG480    CCGGTTCA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCCAAACCGAAC-91199699119979-979-989
 AtREG550CCAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556   AACCGAAC PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.