version
PlantPromoterDB promoter information of AT5G27850

Summary of Gene (AT5G27850)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G27850  TAIR      NCBI 
Gene model AT5G27850  
Description 60S ribosomal protein L18 (RPL18C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, vacuole, large ribosomal subunit, membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L18e (InterPro:IPR000039); BEST Arabidopsis thaliana protein match is: RPL18 (RIBOSOMAL PROTEIN L18); structural constituent of ribosome (TAIR:AT3G05590.1); Has 601 Blast hits to 601 proteins in 237 species: Archae - 28; Bacteria - 0; Metazoa - 279; Fungi - 98; Plants - 80; Viruses - 0; Other Eukaryotes - 116 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 9860219-9861418)

Genome position     
from initiation codon
AT5G27820.1         
AT5G27830.1         
AT5G27830.2         
AT5G27830.3         
TSS from cDNA
TSS information
AT5G27850                        5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G27850

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+9873154-15
TSS cloneTclone+9873155-14
TSS clone peakCclone+9873156-13
TSS cloneGclone+9873157-12
TSS cloneCclone+9873158-11

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4+9861262AT5G27830.1, AT5G27830.2, AT5G27830.3
TSS peakG4+9861283AT5G27830.1, AT5G27830.2, AT5G27830.3

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone+9861298AT5G27830.1, AT5G27830.2, AT5G27830.3
TSS cloneTclone+9861305AT5G27830.1, AT5G27830.2, AT5G27830.3

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTTCCTCTC+98612389861248AT5G27830.1, AT5G27830.2, AT5G27830.3
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTTCCGGTTAA+98609729860982AT5G27830.1, AT5G27830.2, AT5G27830.3
 AtREG644TTTCCGGT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534 TTCCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG621  TCCGGTTA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG501   CCGGTTAA PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGTTAAAGCCC+98610179861025AT5G27830.1, AT5G27830.2, AT5G27830.3
 AtREG545TTAAAGCC  PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC PPDB MotifGCCCA  PLACE Motif 
REGCAATTGGG+98612069861213AT5G27830.1, AT5G27830.2, AT5G27830.3
 AtREG647CAATTGGG PPDB Motif  PLACE Motif 
REGTCGGGTCGACCCG+98612179861229AT5G27830.1, AT5G27830.2, AT5G27830.3
 AtREG383TCGGGTCG      PPDB Motif  PLACE Motif 
 AtREG539 CGGGTCGACCCG PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.