version
PlantPromoterDB promoter information of AT5G35360.2

Summary of Gene (AT5G35360.2)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G35360  TAIR      NCBI 
Gene model AT5G35360.2  
Description Encodes biotin carboxylase subunit (CAC2).  
#
#

Overview

Focused view (chromosome 5: 13583300-13584499)

Genome position     
from initiation codon
AT5G35360.1         
TSS from cDNA
TSS information
AT5G35360.2                      5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G35360.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA26+13584175-125

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+13584159-141
TSS cloneAclone+13584168-132
TSS cloneAclone+13584170-130
TSS cloneTclone+13584171-129
TSS cloneTclone+13584198-102

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCTCTCTCTCTCTC+1358419813584214-102-86
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTTAATGGGCTTTAT+1358395813583972-342-328
 AtREG604CTTAATGG        PPDB Motif  PLACE MotifTTAATGG 
 AtREG396 TTAATGGG       PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357  TAATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG372   AATGGGCT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378    ATGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376     TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365      GGGCTTTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG601       GGCTTTAT PPDB Motif  PLACE Motif 
REGTGGCCCATG+1358403613584044-264-256
 AtREG490TGGCCCAT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG504 GGCCCATG PPDB MotifGCCCA, CCATGG  PLACE MotifGGGCC, TGGGCY 
REGCCCATATA+1358404613584053-254-247
 AtREG620CCCATATA PPDB MotifGCCCA  PLACE Motif 
REGTTCCACGT+1358407713584084-223-216
 AtREG627TTCCACGT PPDB MotifACGT  PLACE MotifACGT, ACGTG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.