version
PlantPromoterDB promoter information of AT5G38410.2

Summary of Gene (AT5G38410.2)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G38410  TAIR      NCBI 
Gene model AT5G38410.2  
Description ribulose bisphosphate carboxylase small chain 3B / RuBisCO small subunit 3B (RBCS-3B) (ATS3B); FUNCTIONS IN: ribulose-bisphosphate carboxylase activity; INVOLVED IN: response to blue light, carbon utilization by fixation of carbon dioxide, response to red light, response to far red light; LOCATED IN: thylakoid, chloroplast ribulose bisphosphate carboxylase complex, apoplast, chloroplast, membrane; EXPRESSED IN: 12 plant structures; CONTAINS InterPro DOMAIN/s: Ribulose bisphosphate carboxylase, small chain (InterPro:IPR000894); BEST Arabidopsis thaliana protein match is: ribulose bisphosphate carboxylase small chain 2B / RuBisCO small subunit 2B (RBCS-2B) (ATS2B) (TAIR:AT5G38420.1); Has 29 Blast hits to 29 proteins in 14 species: Archae - 0; Bacteria - 20; Metazoa - 0; Fungi - 0; Plants - 1; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 15379306-15378107)

Genome position     
from initiation codon
AT5G38410.1         
AT5G38410.3         
TSS from cDNA
TSS information
AT5G38410.2                      5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G38410.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2982-15378352-46

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-15378416-110
TSS cloneCclone-15378406-100
TSS cloneAclone-15378357-51
TSS cloneAclone-15378356-50
TSS cloneGclone-15378355-49
TSS cloneTclone-15378354-48
TSS cloneCclone-15378353-47
TSS cloneAclone-15378352-46
TSS cloneGclone-15378351-45
TSS cloneTclone-15378350-44
TSS cloneAclone-15378349-43
TSS cloneAclone-15378348-42
TSS cloneGclone-15378347-41
TSS cloneAclone-15378344-38

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxATTATATAAAGA-1537837915378390-73-84
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGCTTTT-1537840915378416-103-110
 AtREG409GGGCTTTT PPDB MotifGCCCA  PLACE Motif 
REGTAAACGACGT-1537844715378456-141-150
 AtREG565TAAACGAC   PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG  PPDB Motif  PLACE Motif 
 AtREG493  AACGACGT PPDB MotifACGT  PLACE MotifACGT 
REGCTGCCACGTGGCCTTAT-1537851115378527-205-221
 AtREG468CTGCCACG         ABA PPDB Motif  PLACE MotifGCCAC 
 AtREG379 TGCCACGT        ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG367  GCCACGTGGC     ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG425         GGCCTTAT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.