version
PlantPromoterDB promoter information of AT5G38860.1

Summary of Gene (AT5G38860.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G38860  TAIR      NCBI 
Gene model AT5G38860.1  
Description BES1-interacting Myc-like protein 3 (BIM3); FUNCTIONS IN: transcription factor activity, DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: nucleus; CONTAINS InterPro DOMAIN/s: Basic helix-loop-helix dimerisation region bHLH (InterPro:IPR001092), Helix-loop-helix DNA-binding (InterPro:IPR011598); BEST Arabidopsis thaliana protein match is: BIM2 (BES1-interacting Myc-like protein 2); DNA binding / transcription factor (TAIR:AT1G69010.1); Has 805 Blast hits to 803 proteins in 102 species: Archae - 0; Bacteria - 0; Metazoa - 120; Fungi - 24; Plants - 651; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 15558083-15559282)

Genome position     
from initiation codon
AT5G38850.1         
TSS from cDNA
TSS information
AT5G38860.1                      5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G38860.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA10+15558991-92

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATTTGGGCCTGA+1555888115558892-202-191
 AtREG421ATTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  TTGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG370   TGGGCCTG  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG374    GGGCCTGA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTAAATGGGCTTTT+1555890515558917-178-166
 AtREG443TAAATGGG      PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   ATGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376    TGGGCTTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409     GGGCTTTT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.