version
PlantPromoterDB promoter information of AT5G39320.1

Summary of Gene (AT5G39320.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G39320  TAIR      NCBI 
Gene model AT5G39320.1  
Description UDP-glucose 6-dehydrogenase, putative; FUNCTIONS IN: in 6 functions; INVOLVED IN: metabolic process; LOCATED IN: cytosol, nucleus; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: UDP-glucose/GDP-mannose dehydrogenase, N-terminal (InterPro:IPR001732), 6-phosphogluconate dehydrogenase, C-terminal-like (InterPro:IPR008927), UDP-glucose/GDP-mannose dehydrogenase, dimerisation and substrate-binding (InterPro:IPR014028), UDP-glucose/GDP-mannose dehydrogenase, C-terminal (InterPro:IPR014027), NAD(P)-binding (InterPro:IPR016040), UDP-glucose/GDP-mannose dehydrogenase, dimerisation (InterPro:IPR014026), Nucleotide sugar dehydrogenase (InterPro:IPR017476); BEST Arabidopsis thaliana protein match is: UDP-glucose 6-dehydrogenase, putative (TAIR:AT3G29360.2); Has 10074 Blast hits to 10058 proteins in 1240 species: Archae - 198; Bacteria - 3918; Metazoa - 183; Fungi - 74; Plants - 117; Viruses - 14; Other Eukaryotes - 5570 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 15742254-15743453)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G39320.1                      5'->3' (+)
Promoter sequence
















 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G39320.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4+15742791-463

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+15742788-466
TSS cloneGclone+15742791-463
TSS cloneTclone+15742792-462

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTTTCTATAAACT+1574274915742760-505-494
Y PatchCTCTTTCT+1574274615742753-508-501
Y PatchTTCTTCTCCTTCTTCTTCTTCCTC+1574276715742790-487-464
Y PatchTTTCTTCTCCTTCCTC+1574279515742810-459-444
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCTTTTT+1574250115742508-753-746
 AtREG589GGCTTTTT PPDB Motif  PLACE Motif 
REGTTTAACCG+1574273515742742-519-512
 AtREG645TTTAACCG PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.