version
PlantPromoterDB promoter information of AT5G39740.1

Summary of Gene (AT5G39740.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G39740  TAIR      NCBI 
Gene model AT5G39740.1  
Description 60S ribosomal protein L5 (RPL5B); FUNCTIONS IN: structural constituent of ribosome, 5S rRNA binding; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: in 6 components; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L5, eukaryotic (InterPro:IPR005485), Ribosomal protein L18/L5 (InterPro:IPR005484); BEST Arabidopsis thaliana protein match is: ATL5 (A. THALIANA RIBOSOMAL PROTEIN L5); 5S rRNA binding / structural constituent of ribosome (TAIR:AT3G25520.1); Has 941 Blast hits to 940 proteins in 333 species: Archae - 245; Bacteria - 6; Metazoa - 326; Fungi - 108; Plants - 79; Viruses - 0; Other Eukaryotes - 177 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 15902365-15903564)

Genome position     
from initiation codon
AT5G39730.1         
TSS from cDNA
TSS information
AT5G39740.1                      5'->3' (+)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G39740.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG31+15903323-42

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+15903297-68
TSS cloneGclone+15903323-42
TSS cloneCclone+15903324-41
TSS cloneGclone+15903325-40
TSS cloneCclone+15903326-39
TSS cloneCclone+15903327-38
TSS cloneTclone+15903328-37
TSS cloneCclone+15903329-36
TSS cloneTclone+15903330-35
TSS cloneCclone+15903333-32
TSS cloneTclone+15903336-29

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTAAAGGCCCAAATATAAAGCCCATTAGGCCTATA+1590316315903197-202-168
 AtREG639TTAAAGGC                            PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG467 TAAAGGCC                           PPDB Motif  PLACE Motif 
 AtREG359  AAAGGCCC                          PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353   AAGGCCCA                         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356    AGGCCCAA                        PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373     GGCCCAAA                       PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG421      GCCCAAAT                      PPDB MotifGCCCA  PLACE Motif 
 AtREG601              ATAAAGCC              PPDB Motif  PLACE Motif 
 AtREG365               TAAAGCCC             PPDB MotifGCCCA  PLACE Motif 
 AtREG376                AAAGCCCA            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378                 AAGCCCAT           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372                  AGCCCATT          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357                   GCCCATTA         PPDB MotifGCCCA  PLACE Motif 
 AtREG558                    CCCATTAG        PPDB MotifGCCCA  PLACE Motif 
 AtREG506                       ATTAGGCC     PPDB Motif  PLACE Motif 
 AtREG649                          AGGCCTAT  PPDB Motif  PLACE Motif 
 AtREG487                           GGCCTATA PPDB Motif  PLACE Motif 
REGGACCGTTG+1590321615903223-149-142
 AtREG553GACCGTTGAuxin PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
REGTAAGCCCAC+1590323315903241-132-124
 AtREG426TAAGCCCA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG518 AAGCCCAC PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGGAGCCCAA+1590326615903273-99-92
 AtREG533GAGCCCAA PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.