PlantPromoterDB promoter information of AT5G39870.1

Summary of Gene (AT5G39870.1)

Organism	Arabidopsis thaliana
Chromosome	5
Locus	AT5G39870 TAIR NCBI
Gene model	AT5G39870.1
Description	unknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: petal, male gametophyte, flower, cultured cell; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1216 (InterPro:IPR009605); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G28980.1); Has 84 Blast hits to 62 proteins in 16 species: Archae - 2; Bacteria - 5; Metazoa - 3; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 20 (source: NCBI BLink).

#

Overview

Focused view (chromosome 5: 15971011-15969812)

`Genome position from initiation codon` `TSS from cDNA TSS information AT5G39870.1 5'->3' (-) Promoter sequence AT5G39880.1 TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G39870.1

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG None None None

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	None	None	None

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak G 23 + 15970887 AT5G39880.1

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`G`	23	+	15970887	AT5G39880.1

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone G clone + 15970887 AT5G39880.1

TSS clone A clone + 15970889 AT5G39880.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`G`	clone	+	15970887	AT5G39880.1
TSS clone	`A`	clone	+	15970889	AT5G39880.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box AGTATATATAG + 15970852 15970862 AT5G39880.1

Y Patch CTTCCTTC + 15970890 15970897 AT5G39880.1

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`AGTATATATAG`	+	15970852	15970862	AT5G39880.1
Y Patch	`CTTCCTTC`	+	15970890	15970897	AT5G39880.1
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG TACCCTTA + 15970615 15970622 AT5G39880.1

AtREG570 TACCCTTA PPDB Motif ACCCT PLACE Motif