PlantPromoterDB promoter information of AT5G41990.1

Summary of Gene (AT5G41990.1)

Organism	Arabidopsis thaliana
Chromosome	5
Locus	AT5G41990 TAIR NCBI
Gene model	AT5G41990.1
Description	Encodes a member of the WNK family (9 members in all) of protein kinases, the structural design of which is clearly distinct from those of other known protein kinases, such as receptor-like kinases and mitogen-activated protein kinases. Interacts specifically with and phosphorylates AtVHA-C, subunit C of the vacuolar H+-ATPase.

#

Overview

Focused view (chromosome 5: 16814162-16812963)

`Genome position from initiation codon` `AT5G42030.1 AT5G42040.1 TSS from cDNA TSS information AT5G41990.1 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G41990.1

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 8 - 16798000 -438

TSS peak A 8 - 16797820 -258

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	8	-	16798000	-438
TSS peak	`A`	8	-	16797820	-258

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone A clone - 16798026 -464

TSS clone T clone - 16798004 -442

TSS clone T clone - 16797999 -437

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`A`	clone	-	16798026	-464
TSS clone	`T`	clone	-	16798004	-442
TSS clone	`T`	clone	-	16797999	-437

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch CTTTCTCC - 16798013 16798020 -451 -458

Y Patch TTCTTCCT - 16798028 16798035 -466 -473

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`CTTTCTCC`	-	16798013	16798020	-451	-458
Y Patch	`TTCTTCCT`	-	16798028	16798035	-466	-473
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG TTGACTTT - 16798071 16798078 -509 -516

AtREG632 TTGACTTT PPDB Motif PLACE Motif TTGAC

REG GGCCTAAA - 16798172 16798179 -610 -617

AtREG430 GGCCTAAA PPDB Motif PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`TTGACTTT`		-	16798071	16798078	-509	-516
	AtREG632	`TTGACTTT`		PPDB Motif		PLACE Motif	`TTGAC`
REG	`GGCCTAAA`		-	16798172	16798179	-610	-617
	AtREG430	`GGCCTAAA`		PPDB Motif		PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak G 8 - 16813142 AT5G42030.1

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`G`	8	-	16813142	AT5G42030.1

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone T clone - 16813182 AT5G42030.1

TSS clone T clone - 16813095 AT5G42030.1

TSS clone T clone - 16813090 AT5G42030.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`T`	clone	-	16813182	AT5G42030.1
TSS clone	`T`	clone	-	16813095	AT5G42030.1
TSS clone	`T`	clone	-	16813090	AT5G42030.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch TCTTCTTCTCTCTCTTTC - 16813101 16813118 AT5G42030.1

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`TCTTCTTCTCTCTCTTTC`	-	16813101	16813118	AT5G42030.1
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None