PlantPromoterDB promoter information of AT5G41992.1

Summary of Gene (AT5G41992.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G41992  TAIR      NCBI 
Gene model AT5G41992.1  
Description Upstream open reading frames (uORFs) are small open reading frames found in the 5' UTR of a mature mRNA, and can potentially mediate translational regulation of the largest, or major, ORF (mORF). CPuORF58 represents a conserved upstream opening reading frame relative to major ORF AT5G41990.1  


Focused view (chromosome 5: 16799457-16798258)

Genome position     
from initiation codon
TSS from cDNA
TSS information
AT5G41992.1                      5'->3' (-)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

TSS tag distribution(+)

TSS tag distribution(-)


Promoter Summary of AT5G41992.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
TSS peakA8-16798000-93

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
TSS cloneAclone-16798026-119
TSS cloneTclone-16798004-97
TSS cloneTclone-16797999-92

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTTCTCC-1679801316798020-106-113
Y PatchTTCTTCCT-1679802816798035-121-128

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
TSS peakG4+16799316AT5G42000.1, AT5G42000.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
REGCGGGTCGGGTCGGAAAACCGGT+1679910016799121AT5G42000.1, AT5G42000.2
 AtREG442 GGGTCGGG              PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG405  GGTCGGGT             PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG383    TCGGGTCG           PPDB Motif  PLACE Motif 
 AtREG542             AAAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436              AAACCGGT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTAATGGGCCTCT+1679913016799141AT5G42000.1, AT5G42000.2

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.