version
PlantPromoterDB promoter information of AT5G43940.1

Summary of Gene (AT5G43940.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G43940  TAIR      NCBI 
Gene model AT5G43940.1  
Description Encodes a glutathione-dependent formaldehyde dehydrogenase (also known as class III type alcohol dehydrogenase) reduces S-nitrosoglutathione (GSNO), the condensation product of glutathione and NO, that is a naturally occurring NO reservoir and also a reactive nitrogen intermediate. Gene expression is reduced by wounding and induced by salicylic acid. Is required for the acclimation of plants to high temperature and for fertility.  
#
#

Overview

Focused view (chromosome 5: 17683265-17684464)

Genome position     
from initiation codon
AT5G43935.1         
TSS from cDNA
TSS information
AT5G43940.1                      5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G43940.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13+17684202-63

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+17684191-74
TSS cloneAclone+17684200-65
TSS cloneCclone+17684201-64
TSS cloneCclone+17684203-62
TSS cloneCclone+17684206-59
TSS cloneTclone+17684211-54
TSS cloneTclone+17684213-52
TSS cloneAclone+17684214-51
TSS cloneTclone+17684215-50
TSS cloneCclone+17684216-49

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCT+1768420617684213-59-52
Y PatchTCTCTCTTTCTCTCT+1768421517684229-50-36
Y PatchTCTCTCTCT+1768423117684239-34-26
Y PatchTCTCTCTCAT+1768424117684250-24-15
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCTGGGCCTAC+1768408117684091-184-174
 AtREG397TCTGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG410 CTGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358  TGGGCCTA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG435   GGGCCTAC PPDB MotifGCCCA  PLACE MotifGGGCC 
REGCGACCCGACCCGACTCGACCCGG+1768412917684151-136-114
 AtREG383CGACCCGACCCGA           PPDB Motif  PLACE Motif 
 AtREG390 GACCCGACCCGAC          PPDB MotifCCGAC, GGGACCC  PLACE MotifCCGAC 
 AtREG405  ACCCGACC              PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG442   CCCGACCC             PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG375    CCGACCCG            PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG539              TCGACCCG  PPDB Motif  PLACE Motif 
 AtREG494               CGACCCGG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.