version
PlantPromoterDB promoter information of AT5G45300.2

Summary of Gene (AT5G45300.2)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G45300  TAIR      NCBI 
Gene model AT5G45300.2  
Description BETA-AMYLASE 2 (BMY2); FUNCTIONS IN: cation binding, beta-amylase activity, catalytic activity; INVOLVED IN: cellulose biosynthetic process, carbohydrate metabolic process, polysaccharide catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 14 (InterPro:IPR001554), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), BZR1, transcriptional repressor (InterPro:IPR008540); BEST Arabidopsis thaliana protein match is: BAM7 (BETA-AMYLASE 7); beta-amylase/ catalytic/ cation binding (TAIR:AT2G45880.1); Has 843 Blast hits to 824 proteins in 149 species: Archae - 0; Bacteria - 74; Metazoa - 196; Fungi - 10; Plants - 492; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 18352186-18353385)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G45300.2                      5'->3' (+)
Promoter sequence

 
AT5G45290.1         
AT5G45290.2         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G45300.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG2+18353605-31
TSS peakA2+18353630-6

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+18353608-28
TSS cloneGclone+18353613-23

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGTGTCAT+1835337118353378-265-258
 AtREG438CGTGTCATABA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG4-18352563AT5G45290.1, AT5G45290.2
TSS peakG4-18352483AT5G45290.1, AT5G45290.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-18352473AT5G45290.1, AT5G45290.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTTCTTC-1835245718352467AT5G45290.1, AT5G45290.2
Y PatchTCTCTCTCTCT-1835248718352497AT5G45290.1, AT5G45290.2
Y PatchTTCCCTCTC-1835253218352540AT5G45290.1, AT5G45290.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.