PlantPromoterDB promoter information of AT5G45300.2

Summary of Gene (AT5G45300.2)

Organism	Arabidopsis thaliana
Chromosome	5
Locus	AT5G45300 TAIR NCBI
Gene model	AT5G45300.2
Description	BETA-AMYLASE 2 (BMY2); FUNCTIONS IN: cation binding, beta-amylase activity, catalytic activity; INVOLVED IN: cellulose biosynthetic process, carbohydrate metabolic process, polysaccharide catabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase, family 14 (InterPro:IPR001554), Glycoside hydrolase, catalytic core (InterPro:IPR017853), Glycoside hydrolase, subgroup, catalytic core (InterPro:IPR013781), BZR1, transcriptional repressor (InterPro:IPR008540); BEST Arabidopsis thaliana protein match is: BAM7 (BETA-AMYLASE 7); beta-amylase/ catalytic/ cation binding (TAIR:AT2G45880.1); Has 843 Blast hits to 824 proteins in 149 species: Archae - 0; Bacteria - 74; Metazoa - 196; Fungi - 10; Plants - 492; Viruses - 0; Other Eukaryotes - 71 (source: NCBI BLink).

#

Overview

Focused view (chromosome 5: 18352386-18353585)

`Genome position from initiation codon` `TSS from cDNA TSS information AT5G45300.2 5'->3' (+) Promoter sequence AT5G45290.1 AT5G45290.2 TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G45300.2

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak G 2 + 18353605 -31

TSS peak A 2 + 18353630 -6

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`G`	2	+	18353605	-31
TSS peak	`A`	2	+	18353630	-6

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone C clone + 18353608 -28

TSS clone G clone + 18353613 -23

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`C`	clone	+	18353608	-28
TSS clone	`G`	clone	+	18353613	-23

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG CGTGTCAT + 18353371 18353378 -265 -258

AtREG438 CGTGTCAT ABA PPDB Motif PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`CGTGTCAT`		+	18353371	18353378	-265	-258
	AtREG438	`CGTGTCAT`	ABA	PPDB Motif		PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak G 4 - 18352563 AT5G45290.1, AT5G45290.2

TSS peak G 4 - 18352483 AT5G45290.1, AT5G45290.2

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`G`	4	-	18352563	AT5G45290.1, AT5G45290.2
TSS peak	`G`	4	-	18352483	AT5G45290.1, AT5G45290.2

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone G clone - 18352473 AT5G45290.1, AT5G45290.2

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`G`	clone	-	18352473	AT5G45290.1, AT5G45290.2

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch TCTCCTTCTTC - 18352457 18352467 AT5G45290.1, AT5G45290.2

Y Patch TCTCTCTCTCT - 18352487 18352497 AT5G45290.1, AT5G45290.2

Y Patch TTCCCTCTC - 18352532 18352540 AT5G45290.1, AT5G45290.2

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`TCTCCTTCTTC`	-	18352457	18352467	AT5G45290.1, AT5G45290.2
Y Patch	`TCTCTCTCTCT`	-	18352487	18352497	AT5G45290.1, AT5G45290.2
Y Patch	`TTCCCTCTC`	-	18352532	18352540	AT5G45290.1, AT5G45290.2
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None