version
PlantPromoterDB promoter information of AT5G45390.1

Summary of Gene (AT5G45390.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G45390  TAIR      NCBI 
Gene model AT5G45390.1  
Description One of several nuclear-encoded ClpPs (caseinolytic protease). Contains a highly conserved catalytic triad of Ser-type proteases (Ser-His-Asp). The name reflects nomenclature described in Adam et. al (2001).  
#
#

Overview

Focused view (chromosome 5: 18395351-18396550)

Genome position     
from initiation codon
AT5G45380.1         
TSS from cDNA
TSS information
AT5G45390.1                      5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G45390.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA15+18396312-39

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+18396304-47
TSS cloneAclone+18396306-45
TSS cloneCclone+18396310-41
TSS cloneCclone+18396313-38
TSS cloneTclone+18396336-15

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTTCTTTCTTCTTCC+1839627018396287-81-64
Y PatchCTTTCTTCTTCTTC+1839632818396341-23-10
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAATAGGCCAGGGCCCAATAAACCGT+1839616918396193-182-158
 AtREG424AATAGGCC                  PPDB Motif  PLACE Motif 
 AtREG400        AGGGCCCA          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG392         GGGCCCAA         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352          GGCCCAAT        PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355           GCCCAATA       PPDB MotifGCCCA  PLACE Motif 
 AtREG417            CCCAATAA      PPDB MotifGCCCA  PLACE Motif 
 AtREG598                ATAAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG652                 TAAACCGT PPDB Motif  PLACE Motif 
REGAACCCGACCCG+1839622618396236-125-115
 AtREG580AACCCGAC    PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG405 ACCCGACC   PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG442  CCCGACCC  PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG375   CCGACCCG PPDB MotifCCGAC  PLACE MotifCCGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.