version
PlantPromoterDB promoter information of AT5G45900.1

Summary of Gene (AT5G45900.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G45900  TAIR      NCBI 
Gene model AT5G45900.1  
Description Component of autophagy conjugation pathway. Required for proper senescence.  
#
#

Overview

Focused view (chromosome 5: 18614304-18615503)

Genome position     
from initiation codon
AT5G45890.1         
TSS from cDNA
TSS information
AT5G45900.1                      5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G45900.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4+18615244-60
TSS peakG4+18615276-28

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+18614528-776
TSS cloneAclone+18615244-60

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTTCTTCTTTCTC+1861522818615243-76-61
Y PatchCTCTCCTCC+1861525518615263-49-41
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATAAACCGAA+1861505718615066-247-238
 AtREG598ATAAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGGTCCGGTTAA+1861510418615113-200-191
 AtREG573GTCCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG621 TCCGGTTA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG501  CCGGTTAA PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGATAAACCGGTTTT+1861513318615145-171-159
 AtREG598ATAAACCG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436  AAACCGGTTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG542     CCGGTTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGATAAAGCCGACCCGACCCGG+1861515918615178-145-126
 AtREG601ATAAAGCC             PPDB Motif  PLACE Motif 
 AtREG375      CCGACCCGACCCG  PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG383       CGACCCGA      PPDB Motif  PLACE Motif 
 AtREG390        GACCCGAC     PPDB MotifCCGAC, GGGACCC  PLACE MotifCCGAC 
 AtREG405         ACCCGACC    PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG442          CCCGACCC   PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG494            CGACCCGG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.