version
PlantPromoterDB promoter information of AT5G46750.1

Summary of Gene (AT5G46750.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G46750  TAIR      NCBI 
Gene model AT5G46750.1  
Description A member of ARF GAP domain (AGD), A thaliana has 15 members, grouped into four classes.  
#
#

Overview

Focused view (chromosome 5: 18972817-18971618)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G46750.1                      5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G46750.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4-18971883-66
TSS peakA4-18971840-23

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-18971905-88
TSS cloneGclone-18971843-26

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTATTGGGCCATACAAGCCCAT-1897197318971994-156-177
 AtREG417TTATTGGG               PPDB MotifGCCCA  PLACE Motif 
 AtREG355 TATTGGGC              PPDB MotifGCCCA  PLACE Motif 
 AtREG352  ATTGGGCC             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420   TTGGGCCA            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG437    TGGGCCAT           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG479     GGGCCATA          PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG525             CAAGCCCA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378              AAGCCCAT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGATATGGGCTTAT-1897199818972009-181-192
 AtREG432ATATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG477 TATGGGCT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  ATGGGCTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426   TGGGCTTA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG462    GGGCTTAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.