PlantPromoterDB promoter information of AT5G47060

Summary of Gene (AT5G47060)

Organism	Arabidopsis thaliana
Chromosome	5
Locus	AT5G47060 TAIR NCBI
Gene model	AT5G47060
Description	senescence-associated protein-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF581 (InterPro:IPR007650); BEST Arabidopsis thaliana protein match is: senescence-associated protein-related (TAIR:AT4G17670.1); Has 303 Blast hits to 303 proteins in 19 species: Archae - 0; Bacteria - 0; Metazoa - 14; Fungi - 0; Plants - 289; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).

#

Overview

Focused view (chromosome 5: 19120093-19121292)

`Genome position from initiation codon` `TSS from cDNA TSS information AT5G47060 5'->3' (+) Promoter sequence AT5G47070.1 TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G47060

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 17 + 19116791 -52

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	17	+	19116791	-52

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone A clone + 19116789 -54

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`A`	clone	+	19116789	-54

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box TTGCTATAAAAT + 19116752 19116763 -91 -80

Y Patch CTTTCTTC + 19116775 19116782 -68 -61

Y Patch CCTCTCTCTCTTTC + 19116798 19116811 -45 -32

Y Patch CTTTCTCTCT + 19116813 19116822 -30 -21

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`TTGCTATAAAAT`	+	19116752	19116763	-91	-80
Y Patch	`CTTTCTTC`	+	19116775	19116782	-68	-61
Y Patch	`CCTCTCTCTCTTTC`	+	19116798	19116811	-45	-32
Y Patch	`CTTTCTCTCT`	+	19116813	19116822	-30	-21
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG AAACCGAA + 19116521 19116528 -322 -315

AtREG568 AAACCGAA PPDB Motif AACCG(G/A) PLACE Motif

REG TAAAAGCC + 19116664 19116671 -179 -172

AtREG549 TAAAAGCC PPDB Motif PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`AAACCGAA`		+	19116521	19116528	-322	-315
	AtREG568	`AAACCGAA`		PPDB Motif	`AACCG(G/A)`	PLACE Motif
REG	`TAAAAGCC`		+	19116664	19116671	-179	-172
	AtREG549	`TAAAAGCC`		PPDB Motif		PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak T 4 - 19120910 AT5G47070.1

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`T`	4	-	19120910	AT5G47070.1

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone A clone - 19120909 AT5G47070.1

TSS clone A clone - 19120723 AT5G47070.1

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`A`	clone	-	19120909	AT5G47070.1
TSS clone	`A`	clone	-	19120723	AT5G47070.1

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch TTTCTTCTCTTCTTTCTCC - 19120931 19120949 AT5G47070.1

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`TTTCTTCTCTTCTTTCTCC`	-	19120931	19120949	AT5G47070.1
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None