version
PlantPromoterDB promoter information of AT5G47110

Summary of Gene (AT5G47110)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G47110  TAIR      NCBI 
Gene model AT5G47110  
Description lil3 protein, putative; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photosynthesis, light harvesting; LOCATED IN: chloroplast thylakoid membrane, chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: LIL3:1; transcription factor (TAIR:AT4G17600.1); Has 51 Blast hits to 51 proteins in 19 species: Archae - 0; Bacteria - 6; Metazoa - 0; Fungi - 0; Plants - 44; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 19136238-19135039)

Genome position     
from initiation codon
AT5G47110.1         
TSS from cDNA
TSS information
AT5G47110                        5'->3' (-)
Promoter sequence








 
AT5G47120.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G47110

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA34-19135340-102

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-19135350-112
TSS cloneCclone-19135337-99
TSS cloneAclone-19135326-88

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCCTTC-1913535819135365-120-127
Y PatchTCTCTTTC-1913536719135374-129-136
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAACGACA-1913540419135412-166-174
 AtREG520AAAACGAC  PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA PPDB Motif  PLACE Motif 
REGCAAAGCCCATTAA-1913548819135500-250-262
 AtREG559CAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG376 AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372   AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357    GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG396     CCCATTAA PPDB MotifGCCCA  PLACE MotifTTAATGG 
REGTATATGGGCTGA-1913550419135515-266-277
 AtREG620TATATGGG     PPDB MotifGCCCA  PLACE Motif 
 AtREG432 ATATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG477  TATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG609    TGGGCTGA PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA60+19136023AT5G47120.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+19136024AT5G47120.1
TSS cloneTclone+19136027AT5G47120.1
TSS cloneTclone+19136028AT5G47120.1
TSS cloneTclone+19136033AT5G47120.1
TSS cloneAclone+19136035AT5G47120.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxCATTATAAATA+1913598919135999AT5G47120.1
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGATCCACGTGGAT+1913576819135779AT5G47120.1
 AtREG408 TCCACGTGGA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG547ATCCACGTGGATABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGCTTATTGG+1913578419135791AT5G47120.1
 AtREG611CTTATTGG PPDB Motif  PLACE Motif 
REGTACACGTGTA+1913591019135919AT5G47120.1
 AtREG453TACACGTGTAABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACACNNG 
REGTAAGGGTATT+1913594919135958AT5G47120.1
 AtREG570TAAGGGTA   PPDB MotifACCCT  PLACE Motif 
 AtREG623 AAGGGTAT  PPDB MotifACCCT  PLACE Motif 
 AtREG567  AGGGTATT PPDB MotifACCCT  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.