version
PlantPromoterDB promoter information of AT5G47200.1

Summary of Gene (AT5G47200.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G47200  TAIR      NCBI 
Gene model AT5G47200.1  
Description ATRAB1A; FUNCTIONS IN: GTP binding; INVOLVED IN: protein transport, small GTPase mediated signal transduction; LOCATED IN: plasma membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ras GTPase (InterPro:IPR001806), Small GTP-binding protein (InterPro:IPR005225), Ras (InterPro:IPR013753), Ras small GTPase, Rab type (InterPro:IPR003579); BEST Arabidopsis thaliana protein match is: ATRAB1C; GTP binding (TAIR:AT4G17530.1); Has 23714 Blast hits to 23664 proteins in 649 species: Archae - 17; Bacteria - 107; Metazoa - 13262; Fungi - 2840; Plants - 2236; Viruses - 19; Other Eukaryotes - 5233 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 19166029-19167228)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G47200.1                      5'->3' (+)
Promoter sequence




 
AT5G47190.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G47200.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG17+19166935-94

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+19166930-99
TSS cloneAclone+19166931-98
TSS cloneAclone+19166932-97
TSS cloneAclone+19166933-96

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTCTCTC+1916694419166953-85-76
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCACGTCAGC+1916679519166805-234-224
 AtREG388GCCACGTC    PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG419 CCACGTCA   PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG440  CACGTCAG ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG515   ACGTCAGCSA PPDB MotifACGT  PLACE MotifACGT 
REGCAAAACGC+1916682219166829-207-200
 AtREG585CAAAACGC PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
REGGTGGGTCCC+1916684819166856-181-173
 AtREG523GTGGGTCC  PPDB MotifGGGACCC  PLACE Motif 
 AtREG615 TGGGTCCCABA PPDB MotifGGGACCC  PLACE Motif 
REGCTTAACCGTGTCAT+1916687119166884-158-145
 AtREG605CTTAACCG       PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG438      CGTGTCATABA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-19166106AT5G47190.1
TSS cloneCclone-19166093AT5G47190.1
TSS clone peakGclone-19166076AT5G47190.1
TSS cloneTclone-19166071AT5G47190.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.