PlantPromoterDB promoter information of AT5G47720.4

Summary of Gene (AT5G47720.4)

Organism	Arabidopsis thaliana
Chromosome	5
Locus	AT5G47720 TAIR NCBI
Gene model	AT5G47720.4
Description	acetyl-CoA C-acyltransferase, putative / 3-ketoacyl-CoA thiolase, putative; FUNCTIONS IN: acetyl-CoA C-acetyltransferase activity, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: cellular_component unknown; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Thiolase-like (InterPro:IPR016039), Thiolase (InterPro:IPR002155), Thiolase-like, subgroup (InterPro:IPR016038); BEST Arabidopsis thaliana protein match is: ACAT2 (ACETOACETYL-COA THIOLASE 2); acetyl-CoA C-acetyltransferase/ catalytic (TAIR:AT5G48230.2); Has 16032 Blast hits to 16016 proteins in 1334 species: Archae - 254; Bacteria - 8419; Metazoa - 813; Fungi - 434; Plants - 145; Viruses - 0; Other Eukaryotes - 5967 (source: NCBI BLink).

#

Overview

Focused view (chromosome 5: 19330762-19331961)

`Genome position from initiation codon` AT5G47710.1 AT5G47710.2 AT5G47720.1 AT5G47720.2 AT5G47720.3 AT5G47720.5 TSS from cDNA TSS information AT5G47720.4 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G47720.4

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone peak T clone + 19331547 -215

TSS clone G clone + 19331657 -105

TSS clone peak A clone + 19331703 -59

TSS clone T clone + 19331726 -36

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone peak	`T`	clone	+	19331547	-215
TSS clone	`G`	clone	+	19331657	-105
TSS clone peak	`A`	clone	+	19331703	-59
TSS clone	`T`	clone	+	19331726	-36

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch CTCTTCCT + 19331339 19331346 -423 -416

Y Patch TTTCTTCTT + 19331351 19331359 -411 -403

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	`CTCTTCCT`	+	19331339	19331346	-423	-416
Y Patch	`TTTCTTCTT`	+	19331351	19331359	-411	-403
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG AGGGTATTT + 19331183 19331191 -579 -571

AtREG567 AGGGTATT PPDB Motif ACCCT PLACE Motif

AtREG602 GGGTATTT PPDB Motif PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`AGGGTATTT`		+	19331183	19331191	-579	-571
	AtREG567	`AGGGTATT`		PPDB Motif	`ACCCT`	PLACE Motif
	AtREG602	`GGGTATTT`		PPDB Motif		PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None