version
PlantPromoterDB promoter information of AT5G47900.3

Summary of Gene (AT5G47900.3)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G47900  TAIR      NCBI 
Gene model AT5G47900.3  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; EXPRESSED IN: 18 plant structures; EXPRESSED DURING: 10 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G27730.1); Has 677 Blast hits to 602 proteins in 130 species: Archae - 0; Bacteria - 264; Metazoa - 99; Fungi - 0; Plants - 60; Viruses - 0; Other Eukaryotes - 254 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 19387508-19388707)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G47900.3                      5'->3' (+)
Promoter sequence

 
AT5G47880.1         
AT5G47880.2         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence











 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G47900.3

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA21-19388562AT5G47880.1, AT5G47880.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-19388562AT5G47880.1, AT5G47880.2
TSS cloneTclone-19388561AT5G47880.1, AT5G47880.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxTTATATATATTC-1938858819388599AT5G47880.1, AT5G47880.2
Y PatchTCTCTTTCTCT-1938857919388589AT5G47880.1, AT5G47880.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAGTCGGTT-1938864019388647AT5G47880.1, AT5G47880.2
 AtREG641AGTCGGTT PPDB MotifAACCG(G/A), CCGAC  PLACE MotifCCGAC, RCCGAC 
REGTACTGGGCTTAGGCCCATTAA-1938865119388671AT5G47880.1, AT5G47880.2
 AtREG434TACTGGGC              PPDB MotifGCCCA  PLACE Motif 
 AtREG426   TGGGCTTA           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG634    GGGCTTAG          PPDB MotifGCCCA  PLACE Motif 
 AtREG563       CTTAGGCC       PPDB Motif  PLACE Motif 
 AtREG360        TTAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358         TAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354          AGGCCCAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361           GGCCCATT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357            GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG396             CCCATTAA PPDB MotifGCCCA  PLACE MotifTTAATGG 
REGTTCGGCCCATTAAG-1938868519388698AT5G47880.1, AT5G47880.2
 AtREG427TTCGGCCC       PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG393 TCGGCCCA      PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380  CGGCCCAT     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361   GGCCCATT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357    GCCCATTA   PPDB MotifGCCCA  PLACE Motif 
 AtREG396     CCCATTAA  PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG604      CCATTAAG PPDB Motif  PLACE MotifTTAATGG 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.