PlantPromoterDB promoter information of AT5G47910.1
Summary of Gene (AT5G47910.1)
|
Overview
|
Focused view (chromosome 5: 19407285-19408484)
|
Genome position
from initiation codon TSS from cDNA TSS information AT5G47910.1 5'->3' (+) Promoter sequence AT5G47930.1
TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT5G47910.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | G | 2 | + | 19397312 | -273 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | A | clone | + | 19397443 | -142 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | ATGACACG | + | 19397195 | 19397202 | -390 | -383 | |||
| AtREG438 | ATGACACG | ABA | PPDB Motif | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| TSS peak | A | 31 | - | 19407398 | AT5G47930.1 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| TSS clone | A | clone | - | 19407398 | AT5G47930.1 |
| TSS clone | G | clone | - | 19407397 | AT5G47930.1 |
| TSS clone | T | clone | - | 19407394 | AT5G47930.1 |
| TSS clone | C | clone | - | 19407392 | AT5G47930.1 |
| TSS clone | G | clone | - | 19407391 | AT5G47930.1 |
| TSS clone | T | clone | - | 19407390 | AT5G47930.1 |
| TSS clone | C | clone | - | 19407389 | AT5G47930.1 |
| TSS clone | G | clone | - | 19407383 | AT5G47930.1 |
| TSS clone | G | clone | - | 19407376 | AT5G47930.1 |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | CATATATAC | - | 19407420 | 19407428 | AT5G47930.1 | |
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | CAATGGGCTGGGCCTATAAGGCCCAATG | - | 19407459 | 19407486 | AT5G47930.1 | ||||
| AtREG551 | CAATGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG372 | AATGGGCT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG454 | GGCTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG410 | CTGGGCCT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG358 | TGGGCCTA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG362 | GGGCCTAT | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG487 | GGCCTATA | PPDB Motif | PLACE Motif | ||||||
| AtREG425 | ATAAGGCC | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG351 | TAAGGCCC | PPDB Motif | GCCCA | PLACE Motif | GGGCC | ||||
| AtREG353 | AAGGCCCA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG356 | AGGCCCAA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG352 | GGCCCAAT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG461 | GCCCAATG | PPDB Motif | GCCCA | PLACE Motif | |||||