version
PlantPromoterDB promoter information of AT5G48330

Summary of Gene (AT5G48330)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G48330  TAIR      NCBI 
Gene model AT5G48330  
Description regulator of chromosome condensation (RCC1) family protein; FUNCTIONS IN: binding; INVOLVED IN: biological_process unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (InterPro:IPR009091), Regulator of chromosome condensation, RCC1 (InterPro:IPR000408); BEST Arabidopsis thaliana protein match is: UVR8 (UVB-RESISTANCE 8); chromatin binding / guanyl-nucleotide exchange factor (TAIR:AT5G63860.1); Has 15456 Blast hits to 4421 proteins in 299 species: Archae - 76; Bacteria - 1677; Metazoa - 5981; Fungi - 696; Plants - 1366; Viruses - 2; Other Eukaryotes - 5658 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 19586939-19588138)

Genome position     
from initiation codon
AT5G48330.1         
AT5G48330.2         
AT5G48335.1         
TSS from cDNA
TSS information
AT5G48330                        5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G48330

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+19585907-82
TSS clone peakAclone+19585908-81
TSS cloneAclone+19585936-53

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG8+19588026AT5G48335.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+19587993AT5G48335.1
TSS cloneCclone+19588009AT5G48335.1
TSS cloneGclone+19588024AT5G48335.1
TSS cloneGclone+19588026AT5G48335.1
TSS cloneAclone+19588060AT5G48335.1
TSS cloneGclone+19588075AT5G48335.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCCAATAT+1958773519587742AT5G48335.1
 AtREG509CCCAATAT PPDB Motif  PLACE Motif 
REGTTTCCGGTTCGGT+1958794319587955AT5G48335.1
 AtREG644TTTCCGGT      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534 TTCCGGTT     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579  TCCGGTTC    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423   CCGGTTCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG456    CGGTTCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451     GGTTCGGT PPDB Motif  PLACE Motif 
REGTTCGGTTT+1958796619587973AT5G48335.1
 AtREG568TTCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.