PlantPromoterDB promoter information of AT5G48465
Summary of Gene (AT5G48465)
|
Overview
|
Focused view (chromosome 5: 19642603-19641404)
|
Genome position
TSS from cDNA TSS information AT5G48465 5'->3' (-) Promoter sequence AT5G48465.1
AT5G48470.1 TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT5G48465
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | None | None | None | ||||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| TSS peak | A | 4 | + | 19641713 | AT5G48470.1 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | CGTCTTCTTC | + | 19641726 | 19641735 | AT5G48470.1 | |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | ATAACCGGT | + | 19641466 | 19641474 | AT5G48470.1 | ||||
| AtREG548 | ATAACCGG | PPDB Motif | AACCG(G/A) | PLACE Motif | CNGTTR | ||||
| AtREG503 | TAACCGGT | PPDB Motif | AACCG(G/A) | PLACE Motif | CNGTTR | ||||
| REG | AGCGCGTGGCTTTTAACCACGTGGT | + | 19641624 | 19641648 | AT5G48470.1 | ||||
| AtREG381 | AGCGCGTG | PPDB Motif | ACGCGC | PLACE Motif | |||||
| AtREG608 | CGTGGCTT | ABA | PPDB Motif | PLACE Motif | GCCAC | ||||
| AtREG549 | GGCTTTTA | PPDB Motif | PLACE Motif | ||||||
| AtREG544 | ACCACGTGGT | ABA, DREB1Aox | PPDB Motif | ACGT | PLACE Motif | ACGT, ACGTG | |||