PlantPromoterDB promoter information of AT5G48900

Summary of Gene (AT5G48900)

Organism	Arabidopsis thaliana
Chromosome	5
Locus	AT5G48900 TAIR NCBI
Gene model	AT5G48900
Description	pectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT3G07010.1); Has 906 Blast hits to 903 proteins in 156 species: Archae - 0; Bacteria - 367; Metazoa - 0; Fungi - 133; Plants - 398; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).

#

Overview

Focused view (chromosome 5: 19817440-19818639)

`Genome position from initiation codon` `TSS from cDNA TSS information AT5G48900 5'->3' (+) Promoter sequence AT5G48880.1 AT5G48880.3 TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G48900

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 10 + 19825137 -103

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	10	+	19825137	-103

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone A clone + 19825137 -103

TSS clone A clone + 19825138 -102

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`A`	clone	+	19825137	-103
TSS clone	`A`	clone	+	19825138	-102

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box CTCTTATATAAT + 19825099 19825110 -141 -130

Y Patch CTTCCTTCTTCCTTCTTCTTCTT + 19825149 19825171 -91 -69

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`CTCTTATATAAT`	+	19825099	19825110	-141	-130
Y Patch	`CTTCCTTCTTCCTTCTTCTTCTT`	+	19825149	19825171	-91	-69
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG ATTAGGCC + 19825054 19825061 -186 -179

AtREG506 ATTAGGCC PPDB Motif PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`ATTAGGCC`		+	19825054	19825061	-186	-179
	AtREG506	`ATTAGGCC`		PPDB Motif		PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

TSS peak A 4 - 19817843 AT5G48880.2, AT5G48880.3

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
TSS peak	`A`	4	-	19817843	AT5G48880.2, AT5G48880.3

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

TSS clone T clone - 19817839 AT5G48880.2, AT5G48880.3

TSS clone T clone - 19817831 AT5G48880.2, AT5G48880.3

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
TSS clone	`T`	clone	-	19817839	AT5G48880.2, AT5G48880.3
TSS clone	`T`	clone	-	19817831	AT5G48880.2, AT5G48880.3

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box TTGTATATATAAT - 19817864 19817876 AT5G48880.2, AT5G48880.3

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`TTGTATATATAAT`	-	19817864	19817876	AT5G48880.2, AT5G48880.3
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None