PlantPromoterDB promoter information of AT5G48900

Summary of Gene (AT5G48900)

Organism	Arabidopsis thaliana
Chromosome	5
Locus	AT5G48900 TAIR NCBI
Gene model	AT5G48900
Description	pectate lyase family protein; FUNCTIONS IN: lyase activity, pectate lyase activity; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Pectin lyase fold/virulence factor (InterPro:IPR011050), AmbAllergen (InterPro:IPR018082), Pectate lyase/Amb allergen (InterPro:IPR002022), Pectin lyase fold (InterPro:IPR012334), Parallel beta-helix repeat (InterPro:IPR006626); BEST Arabidopsis thaliana protein match is: pectate lyase family protein (TAIR:AT3G07010.1); Has 906 Blast hits to 903 proteins in 156 species: Archae - 0; Bacteria - 367; Metazoa - 0; Fungi - 133; Plants - 398; Viruses - 0; Other Eukaryotes - 8 (source: NCBI BLink).

#

Overview

Focused view (chromosome 5: 19831140-19832339)

`Genome position from initiation codon` `AT5G48905.1 TSS from cDNA TSS information AT5G48900 5'->3' (+) Promoter sequence TSS from cDNA TSS information 3'->5' (-) Promoter sequence TSS tag distribution(+) TSS tag distribution(-)`	Your web browser cannot display this window!

ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G48900

TSS information

Type Sequence TPM score Genome position Position from initiation codon

Strand Position Position

TSS peak A 10 + 19825137 -103

Type	Sequence	TPM score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS peak	`A`	10	+	19825137	-103

TSS information from cDNA

Type Sequence Score Genome position Position from initiation codon

Strand Position Position

TSS clone A clone + 19825137 -103

TSS clone A clone + 19825138 -102

Type	Sequence	Score	Genome position	Position from initiation codon
			Strand	Position	Position
TSS clone	`A`	clone	+	19825137	-103
TSS clone	`A`	clone	+	19825138	-102

Core promoter information

Type Sequence Genome position Position from initiation codon

Strand Start End Start End

initiator Not Available Not Available Not Available

TATA Box CTCTTATATAAT + 19825099 19825110 -141 -130

Y Patch CTTCCTTCTTCCTTCTTCTTCTT + 19825149 19825171 -91 -69

GA None None None

Inr None None None

Type	Sequence	Genome position	Position from initiation codon
		Strand	Start	End	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	`CTCTTATATAAT`	+	19825099	19825110	-141	-130
Y Patch	`CTTCCTTCTTCCTTCTTCTTCTT`	+	19825149	19825171	-91	-69
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Position from initiation codon

Strand Start End Start End

REG ATTAGGCC + 19825054 19825061 -186 -179

AtREG506 ATTAGGCC PPDB Motif PLACE Motif

Type	Sequence	Annotation	Genome position	Position from initiation codon
			Strand	Start	End	Start	End
REG	`ATTAGGCC`		+	19825054	19825061	-186	-179
	AtREG506	`ATTAGGCC`		PPDB Motif		PLACE Motif

Other Reliable Promoter Summary

TSS information

Type Sequence TPM score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	TPM score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

TSS information from cDNA

Type Sequence Score Genome position Gene model

Strand Position

Not Available Not Available Not Available Not Available Not Available

Type	Sequence	Score	Genome position	Gene model
			Strand	Position
Not Available	Not Available	Not Available	Not Available	Not Available

Core promoter information

Type Sequence Genome position Gene model

Strand Start End

initiator Not Available Not Available Not Available

TATA Box None None None

Y Patch None None None

GA None None None

Inr None None None

Type	Sequence	Genome position	Gene model
		Strand	Start	End
initiator	Not Available	Not Available	Not Available
TATA Box	None	None	None
Y Patch	None	None	None
GA	None	None	None
Inr	None	None	None

REG information

Type Sequence Annotation Genome position Gene model

Strand Start End

REG None None None