PlantPromoterDB promoter information of AT5G50920
Summary of Gene (AT5G50920)
|
Overview
|
Focused view (chromosome 5: 20720800-20719601)
|
Genome position
from initiation codon TSS from cDNA TSS information AT5G50920 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT5G50920
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | A | 5 | - | 20720321 | -521 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | G | clone | - | 20720371 | -571 |
| TSS clone | G | clone | - | 20720369 | -569 |
| TSS clone | G | clone | - | 20720347 | -547 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | CATCTCTCTCTCTCTCTTTTCTTCTTC | - | 20720272 | 20720298 | -472 | -498 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | TCGGTTTACCACGTG | - | 20720480 | 20720494 | -680 | -694 | |||
| AtREG514 | TCGGTTTA | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG519 | CGGTTTAC | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG544 | ACCACGTG | ABA, DREB1Aox | PPDB Motif | ACGT | PLACE Motif | ACGT, ACGTG | |||
| REG | CTAAACCGG | - | 20720530 | 20720538 | -730 | -738 | |||
| AtREG511 | CTAAACCG | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
| AtREG412 | TAAACCGG | PPDB Motif | AACCG(G/A) | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||