version
PlantPromoterDB promoter information of AT5G53300.3

Summary of Gene (AT5G53300.3)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G53300  TAIR      NCBI 
Gene model AT5G53300.3  
Description Encodes a ubiquitin conjugating enzyme.  
#
#

Overview

Focused view (chromosome 5: 21634989-21633790)

Genome position     
from initiation codon
AT5G53300.1         
AT5G53300.2         
TSS from cDNA
TSS information
AT5G53300.3                      5'->3' (-)
Promoter sequence







 
AT5G53310.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence



 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G53300.3

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA73-21634134-145

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-21634227-238
TSS cloneTclone-21634226-237
TSS cloneCclone-21634203-214
TSS cloneTclone-21634189-200
TSS cloneCclone-21634186-197
TSS cloneTclone-21634185-196
TSS cloneTclone-21634184-195
TSS cloneCclone-21634182-193
TSS cloneCclone-21634181-192
TSS cloneCclone-21634180-191
TSS cloneCclone-21634179-190
TSS cloneTclone-21634178-189
TSS cloneAclone-21634176-187
TSS cloneGclone-21634175-186
TSS cloneTclone-21634165-176
TSS cloneTclone-21634159-170
TSS cloneAclone-21634153-164
TSS cloneCclone-21634150-161

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTTCTTCTCTCT-2163415521634168-166-179
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCGTCGTTTC-2163433221634341-343-352
 AtREG439GCGTCGTT   PPDB Motif  PLACE Motif 
 AtREG415 CGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG576  GTCGTTTC PPDB Motif  PLACE Motif 
REGCGATGTCGTTTC-2163437421634385-385-396
 AtREG630CGATGTCG     PPDB Motif  PLACE Motif 
 AtREG569   TGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG576    GTCGTTTC PPDB Motif  PLACE Motif 
REGACCGTTAG-2163440521634412-416-423
 AtREG603ACCGTTAG PPDB Motif  PLACE MotifYAACKG, CNGTTR 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG13+21634626AT5G53310.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+21634591AT5G53310.1
TSS cloneAclone+21634600AT5G53310.1
TSS cloneAclone+21634618AT5G53310.1
TSS cloneAclone+21634622AT5G53310.1
TSS cloneCclone+21634648AT5G53310.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGAAACGACGC+2163433221634341AT5G53310.1
 AtREG576GAAACGAC   PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG  PPDB Motif  PLACE Motif 
 AtREG439  AACGACGC PPDB Motif  PLACE Motif 
REGGAAACGACATCG+2163437421634385AT5G53310.1
 AtREG576GAAACGAC     PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA    PPDB Motif  PLACE Motif 
 AtREG630    CGACATCG PPDB Motif  PLACE Motif 
REGCTAACGGT+2163440521634412AT5G53310.1
 AtREG603CTAACGGT PPDB Motif  PLACE MotifYAACKG, CNGTTR 
REGAAACGCGT+2163449321634500AT5G53310.1
 AtREG633AAACGCGT PPDB MotifAAACG(C/G)  PLACE Motif 
REGAAGCCACGTC+2163456321634572AT5G53310.1
 AtREG608AAGCCACG  ABA PPDB Motif  PLACE MotifGCCAC 
 AtREG450 AGCCACGT ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG388  GCCACGTC PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.